Mutagenetix > Incidental Mutations

Incidental Mutation 'R4359:Gm11639'

324823

Institutional Source

Beutler Lab

Gene Symbol

Gm11639

Ensembl Gene

ENSMUSG00000040838

Gene Name

predicted gene 11639

Synonyms

MMRRC Submission

041670-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R4359 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104685707-105117394 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to T at 104733721 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000148007] [ENSMUST00000212287] [ENSMUST00000212287]

Predicted Effect

probably null
Transcript: ENSMUST00000148007

SMART Domains

Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838

Domain	Start	End	E-Value	Type
low complexity region	40	55	N/A	INTRINSIC
low complexity region	116	129	N/A	INTRINSIC
internal_repeat_4	146	233	3.42e-6	PROSPERO
internal_repeat_3	165	247	2.21e-6	PROSPERO
low complexity region	331	348	N/A	INTRINSIC
internal_repeat_2	349	361	4.38e-8	PROSPERO
internal_repeat_2	371	383	4.38e-8	PROSPERO
low complexity region	385	640	N/A	INTRINSIC
Pfam:EF-hand_8	677	729	8.7e-6	PFAM
low complexity region	835	842	N/A	INTRINSIC
internal_repeat_1	879	1106	2.47e-14	PROSPERO
internal_repeat_4	1015	1108	3.42e-6	PROSPERO

Predicted Effect

probably null
Transcript: ENSMUST00000148007

SMART Domains

Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838

Domain	Start	End	E-Value	Type
low complexity region	40	55	N/A	INTRINSIC
low complexity region	116	129	N/A	INTRINSIC
internal_repeat_4	146	233	3.42e-6	PROSPERO
internal_repeat_3	165	247	2.21e-6	PROSPERO
low complexity region	331	348	N/A	INTRINSIC
internal_repeat_2	349	361	4.38e-8	PROSPERO
internal_repeat_2	371	383	4.38e-8	PROSPERO
low complexity region	385	640	N/A	INTRINSIC
Pfam:EF-hand_8	677	729	8.7e-6	PFAM
low complexity region	835	842	N/A	INTRINSIC
internal_repeat_1	879	1106	2.47e-14	PROSPERO
internal_repeat_4	1015	1108	3.42e-6	PROSPERO

Predicted Effect

probably null
Transcript: ENSMUST00000212287

Predicted Effect

probably null
Transcript: ENSMUST00000212287

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	A	T	11: 29,824,669	S263T	probably benign	Het
Abca13	G	T	11: 9,297,629	V2459F	probably benign	Het
Acot1	T	C	12: 84,014,540	Y207H	probably damaging	Het
Anapc1	A	G	2: 128,623,556	V1668A	possibly damaging	Het
Atr	T	A	9: 95,951,536	I2613N	probably damaging	Het
Baz2b	A	G	2: 59,901,613	I2027T	possibly damaging	Het
C2cd3	T	G	7: 100,441,089	H466Q	probably damaging	Het
Cdc14b	T	A	13: 64,248,411	I15F	probably benign	Het
Cep135	G	T	5: 76,611,714	K438N	possibly damaging	Het
Cnot1	T	C	8: 95,739,848	D1587G	probably damaging	Het
Cxcl16	C	A	11: 70,458,805	V65L	possibly damaging	Het
Dhx36	T	A	3: 62,475,278	T783S	probably benign	Het
Disp3	T	C	4: 148,271,932	N157S	probably benign	Het
Gfod2	T	C	8: 105,717,545	N122S	possibly damaging	Het
Grin3b	T	A	10: 79,972,897	D160E	probably benign	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Htr1b	C	A	9: 81,632,351	A68S	probably benign	Het
Ifit2	A	T	19: 34,573,144	D28V	possibly damaging	Het
Ifna15	G	T	4: 88,557,842	T135N	probably benign	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
Kif24	A	G	4: 41,413,827		probably null	Het
Klhl25	T	C	7: 75,866,732	V462A	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
L3mbtl3	A	G	10: 26,327,741	V397A	unknown	Het
Lpcat2	C	A	8: 92,873,106	P234Q	probably benign	Het
Lrp1b	A	C	2: 40,903,065	C2532W	probably damaging	Het
Malt1	T	C	18: 65,476,229	V768A	probably benign	Het
Mindy3	A	T	2: 12,396,209	W233R	probably damaging	Het
Ncor1	T	C	11: 62,358,910	K1054R	probably damaging	Het
Nin	T	A	12: 70,014,938	T2051S	probably benign	Het
Olfr16	C	A	1: 172,957,080	A95E	probably benign	Het
Olfr616	A	G	7: 103,564,535	F248S	probably benign	Het
Pcsk1	T	C	13: 75,112,719	S354P	possibly damaging	Het
Pilra	T	C	5: 137,831,314	T160A	probably benign	Het
Plekha5	G	C	6: 140,591,688	E540D	probably benign	Het
Prps2	T	A	X: 167,363,549	K176*	probably null	Het
Rasgrf2	C	A	13: 91,890,677	D1017Y	probably damaging	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Spsb1	T	C	4: 149,906,775	H112R	probably damaging	Het
Srd5a3	T	A	5: 76,147,700	F79Y	probably damaging	Het
Stxbp4	C	T	11: 90,494,644	W506*	probably null	Het
Timeless	C	A	10: 128,247,342	Q653K	probably benign	Het
Trio	G	A	15: 27,749,797	Q1129*	probably null	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Zzef1	T	A	11: 72,823,508	S275T	probably damaging	Het

Other mutations in Gm11639

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Gm11639	APN	11	105100021	missense	probably damaging	1.00
IGL01308:Gm11639	APN	11	104720697	missense	probably benign	0.03
IGL01483:Gm11639	APN	11	104739347	missense	probably benign	0.03
IGL01695:Gm11639	APN	11	104736063	missense	probably damaging	1.00
IGL01860:Gm11639	APN	11	104690921	missense	probably benign	0.16
IGL01981:Gm11639	APN	11	104721432	intron	probably benign
IGL01984:Gm11639	APN	11	104738308	missense	probably benign	0.20
IGL02023:Gm11639	APN	11	104721432	intron	probably benign
IGL02252:Gm11639	APN	11	104753927	missense	possibly damaging	0.68
IGL02886:Gm11639	APN	11	105095874	missense	possibly damaging	0.95
IGL03116:Gm11639	APN	11	104721533	missense	probably benign	0.02
IGL03141:Gm11639	APN	11	105095870	missense	probably damaging	0.99
IGL03242:Gm11639	APN	11	105106404	missense	probably damaging	1.00
IGL03274:Gm11639	APN	11	104721093	missense	probably benign	0.03
IGL03408:Gm11639	APN	11	104710621	missense	probably benign	0.03
R0018:Gm11639	UTSW	11	104721552	critical splice donor site	probably null
R0068:Gm11639	UTSW	11	104720822	missense	probably benign	0.29
R0350:Gm11639	UTSW	11	104690880	missense	probably benign	0.03
R0646:Gm11639	UTSW	11	104720501	missense	probably benign	0.03
R0668:Gm11639	UTSW	11	104720492	missense	probably benign	0.16
R0715:Gm11639	UTSW	11	104720880	missense	possibly damaging	0.90
R0944:Gm11639	UTSW	11	104710730	splice site	probably null
R1330:Gm11639	UTSW	11	104746290	missense	possibly damaging	0.84
R1508:Gm11639	UTSW	11	104710677	missense	probably benign	0.03
R1643:Gm11639	UTSW	11	104698978	missense	probably benign	0.16
R1651:Gm11639	UTSW	11	104720666	missense	probably benign	0.03
R1665:Gm11639	UTSW	11	104721114	missense	probably benign	0.07
R1702:Gm11639	UTSW	11	104691006	missense	probably benign	0.03
R1711:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1779:Gm11639	UTSW	11	104720939	missense	probably benign	0.15
R1813:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1818:Gm11639	UTSW	11	104721507	missense	probably benign	0.10
R1896:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1969:Gm11639	UTSW	11	104746264	missense	probably damaging	1.00
R2139:Gm11639	UTSW	11	104751911	missense	possibly damaging	0.53
R2165:Gm11639	UTSW	11	104751862	missense	possibly damaging	0.93
R2359:Gm11639	UTSW	11	104739280	missense	possibly damaging	0.80
R2394:Gm11639	UTSW	11	104738295	missense	probably benign	0.17
R2406:Gm11639	UTSW	11	104720631	missense	probably benign	0.03
R2570:Gm11639	UTSW	11	104733664	missense	probably damaging	1.00
R3795:Gm11639	UTSW	11	104733675	missense	possibly damaging	0.94
R4352:Gm11639	UTSW	11	104739314	missense	probably null	0.25
R4424:Gm11639	UTSW	11	104736114	critical splice donor site	probably null
R4895:Gm11639	UTSW	11	104720286	missense	probably benign	0.16
R4895:Gm11639	UTSW	11	104749670	missense	probably damaging	1.00
R5006:Gm11639	UTSW	11	104729677	splice site	probably null
R5066:Gm11639	UTSW	11	104720664	missense	probably benign	0.03
R5329:Gm11639	UTSW	11	104753806	intron	probably null
R5405:Gm11639	UTSW	11	104721192	missense	probably benign	0.07
R5814:Gm11639	UTSW	11	104736114	critical splice donor site	probably benign
R5888:Gm11639	UTSW	11	104721401	splice site	probably benign
R5910:Gm11639	UTSW	11	104690934	missense	probably benign	0.01
R5975:Gm11639	UTSW	11	104687549	start gained	probably benign
R6019:Gm11639	UTSW	11	105042902	critical splice donor site	probably null
R6028:Gm11639	UTSW	11	104769655	critical splice donor site	probably null
R6048:Gm11639	UTSW	11	104944433	missense	unknown
R6059:Gm11639	UTSW	11	105036769	missense	probably benign	0.03
R6147:Gm11639	UTSW	11	104967740	missense	unknown
R6176:Gm11639	UTSW	11	104792557	missense	probably benign	0.16
R6181:Gm11639	UTSW	11	104831333	missense	probably benign	0.25
R6196:Gm11639	UTSW	11	104855560	missense	probably benign	0.07
R6245:Gm11639	UTSW	11	104785008	missense	probably benign	0.03
R6262:Gm11639	UTSW	11	104893753	missense	probably benign	0.24
R6263:Gm11639	UTSW	11	104919486	missense	unknown
R6277:Gm11639	UTSW	11	105010322	missense	possibly damaging	0.49
R6338:Gm11639	UTSW	11	104843208	nonsense	probably null
R6355:Gm11639	UTSW	11	105005685	missense	probably benign	0.29
R6356:Gm11639	UTSW	11	104893707	missense	probably benign	0.19
R6365:Gm11639	UTSW	11	104924586	missense	unknown
R6391:Gm11639	UTSW	11	104994317	missense	possibly damaging	0.92
R6556:Gm11639	UTSW	11	105008251	missense	probably null	0.03
R6604:Gm11639	UTSW	11	104698946	nonsense	probably null
R6605:Gm11639	UTSW	11	104999281	splice site	probably null
R6634:Gm11639	UTSW	11	104893783	missense	probably benign	0.17
R6851:Gm11639	UTSW	11	105005695	missense	probably benign	0.03
R6862:Gm11639	UTSW	11	104721458	nonsense	probably null
R6949:Gm11639	UTSW	11	104909070	missense	probably damaging	1.00
R6970:Gm11639	UTSW	11	104776356	missense	probably benign	0.03
R7014:Gm11639	UTSW	11	104693422	missense	probably benign	0.03
R7097:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R7122:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R7124:Gm11639	UTSW	11	104738274	missense	probably benign	0.17
R7146:Gm11639	UTSW	11	104967752	missense	unknown
R7146:Gm11639	UTSW	11	105022938	missense	probably benign	0.03
R7154:Gm11639	UTSW	11	104699140	intron	probably null
R7175:Gm11639	UTSW	11	104947411	missense	unknown
R7198:Gm11639	UTSW	11	104751885	missense	probably benign	0.15
R7211:Gm11639	UTSW	11	104710713	missense	probably benign	0.01
R7211:Gm11639	UTSW	11	104724609	critical splice donor site	probably null
R7216:Gm11639	UTSW	11	104880549	missense	possibly damaging	0.49
R7221:Gm11639	UTSW	11	104900606	missense	probably benign	0.36
R7233:Gm11639	UTSW	11	104839843	missense	possibly damaging	0.69
R7236:Gm11639	UTSW	11	104899267	missense	probably benign	0.10
R7262:Gm11639	UTSW	11	104854606	critical splice donor site	probably null
R7289:Gm11639	UTSW	11	105038358	missense	probably benign	0.24
R7323:Gm11639	UTSW	11	105030011	missense	probably benign	0.07
R7378:Gm11639	UTSW	11	104714702	missense	probably benign	0.03
R7388:Gm11639	UTSW	11	104721045	missense	probably damaging	0.97
R7390:Gm11639	UTSW	11	104724585	missense	possibly damaging	0.46
R7411:Gm11639	UTSW	11	104999723	missense	probably benign	0.10
R7468:Gm11639	UTSW	11	104749700	missense	probably benign	0.17
R7497:Gm11639	UTSW	11	104762690	critical splice donor site	probably null
X0026:Gm11639	UTSW	11	104720975	missense	probably benign	0.07
Z1088:Gm11639	UTSW	11	104751902	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CAACTCTTTCAGGTAACAGTTAGTTG -3'
(R):5'- AGGGAGCTAGCAACCACTC -3'

Sequencing Primer
(F):5'- CAGATGGATGTTGCTCAG -3'
(R):5'- ACCCATGAACTGAGAGAAAAATTTC -3'

Posted On

2015-07-06