Incidental Mutation 'R4359:Cdc14b'
ID324827
Institutional Source Beutler Lab
Gene Symbol Cdc14b
Ensembl Gene ENSMUSG00000033102
Gene NameCDC14 cell division cycle 14B
SynonymsA530086E13Rik, 2810432N10Rik
MMRRC Submission 041670-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R4359 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location64189268-64275290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64248411 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 15 (I15F)
Ref Sequence ENSEMBL: ENSMUSP00000105391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039318] [ENSMUST00000109769] [ENSMUST00000109770] [ENSMUST00000221139] [ENSMUST00000221634]
Predicted Effect probably benign
Transcript: ENSMUST00000039318
SMART Domains Protein: ENSMUSP00000046003
Gene: ENSMUSG00000033102

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
Pfam:DSPn 51 189 6.1e-57 PFAM
Pfam:DSPc 240 365 9.2e-17 PFAM
Pfam:Y_phosphatase 244 365 1e-7 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109769
AA Change: I15F

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105391
Gene: ENSMUSG00000033102
AA Change: I15F

DomainStartEndE-ValueType
Pfam:DSPn 12 152 2.5e-58 PFAM
Pfam:DSPc 203 328 8e-17 PFAM
Pfam:Y_phosphatase 206 328 8.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109770
SMART Domains Protein: ENSMUSP00000105392
Gene: ENSMUSG00000033102

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
Pfam:DSPn 51 189 3.4e-57 PFAM
Pfam:DSPc 240 365 2.8e-16 PFAM
Pfam:Y_phosphatase 252 364 2.4e-7 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185652
Predicted Effect probably benign
Transcript: ENSMUST00000221139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221437
Predicted Effect probably benign
Transcript: ENSMUST00000221634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222277
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. This protein is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, which suggests the role in cell cycle control. This protein has been shown to interact with and dephosphorylates tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splice of this gene results in 3 transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature aging, including premature cataracts and kyphosis; reduced fertility, particularly in female mice; and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A T 11: 29,824,669 S263T probably benign Het
Abca13 G T 11: 9,297,629 V2459F probably benign Het
Acot1 T C 12: 84,014,540 Y207H probably damaging Het
Anapc1 A G 2: 128,623,556 V1668A possibly damaging Het
Atr T A 9: 95,951,536 I2613N probably damaging Het
Baz2b A G 2: 59,901,613 I2027T possibly damaging Het
C2cd3 T G 7: 100,441,089 H466Q probably damaging Het
Cep135 G T 5: 76,611,714 K438N possibly damaging Het
Cnot1 T C 8: 95,739,848 D1587G probably damaging Het
Cxcl16 C A 11: 70,458,805 V65L possibly damaging Het
Dhx36 T A 3: 62,475,278 T783S probably benign Het
Disp3 T C 4: 148,271,932 N157S probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm11639 G T 11: 104,733,721 probably null Het
Grin3b T A 10: 79,972,897 D160E probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Htr1b C A 9: 81,632,351 A68S probably benign Het
Ifit2 A T 19: 34,573,144 D28V possibly damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
L3mbtl3 A G 10: 26,327,741 V397A unknown Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp1b A C 2: 40,903,065 C2532W probably damaging Het
Malt1 T C 18: 65,476,229 V768A probably benign Het
Mindy3 A T 2: 12,396,209 W233R probably damaging Het
Ncor1 T C 11: 62,358,910 K1054R probably damaging Het
Nin T A 12: 70,014,938 T2051S probably benign Het
Olfr16 C A 1: 172,957,080 A95E probably benign Het
Olfr616 A G 7: 103,564,535 F248S probably benign Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pilra T C 5: 137,831,314 T160A probably benign Het
Plekha5 G C 6: 140,591,688 E540D probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Stxbp4 C T 11: 90,494,644 W506* probably null Het
Timeless C A 10: 128,247,342 Q653K probably benign Het
Trio G A 15: 27,749,797 Q1129* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zzef1 T A 11: 72,823,508 S275T probably damaging Het
Other mutations in Cdc14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cdc14b APN 13 64215656 missense probably damaging 1.00
IGL00816:Cdc14b APN 13 64205403 missense probably benign 0.10
IGL02569:Cdc14b APN 13 64225614 missense probably benign 0.36
IGL02634:Cdc14b APN 13 64216303 splice site probably benign
IGL02897:Cdc14b APN 13 64247253 missense probably benign 0.00
R0390:Cdc14b UTSW 13 64210192 unclassified probably benign
R0542:Cdc14b UTSW 13 64243683 missense probably benign 0.01
R1022:Cdc14b UTSW 13 64215676 missense probably damaging 1.00
R1024:Cdc14b UTSW 13 64215676 missense probably damaging 1.00
R1676:Cdc14b UTSW 13 64225602 missense possibly damaging 0.93
R1945:Cdc14b UTSW 13 64219890 missense probably damaging 1.00
R1964:Cdc14b UTSW 13 64215537 missense probably damaging 1.00
R3162:Cdc14b UTSW 13 64246608 splice site probably benign
R4598:Cdc14b UTSW 13 64247274 missense probably benign
R4716:Cdc14b UTSW 13 64209200 missense probably damaging 1.00
R6196:Cdc14b UTSW 13 64205524 intron probably benign
R6219:Cdc14b UTSW 13 64205524 intron probably benign
R6361:Cdc14b UTSW 13 64216209 splice site probably null
R6480:Cdc14b UTSW 13 64225650 critical splice acceptor site probably null
R6565:Cdc14b UTSW 13 64225630 missense probably benign 0.01
R6692:Cdc14b UTSW 13 64215563 missense probably damaging 0.98
R7204:Cdc14b UTSW 13 64210198 missense possibly damaging 0.83
R7327:Cdc14b UTSW 13 64225647 missense probably damaging 1.00
R7464:Cdc14b UTSW 13 64196675 nonsense probably null
R7639:Cdc14b UTSW 13 64205329 missense possibly damaging 0.96
R7687:Cdc14b UTSW 13 64209193 missense probably benign 0.15
R8170:Cdc14b UTSW 13 64215735 splice site probably null
Z1176:Cdc14b UTSW 13 64274669 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CACAAATGACCTTTGATCTTTGGCTG -3'
(R):5'- CGCGGCCCTTTAAACTTCAC -3'

Sequencing Primer
(F):5'- TGGACTGGGAATTTCACCAGCTC -3'
(R):5'- GTGTGGTCACACTTTCTTTT -3'
Posted On2015-07-06