Mutagenetix > Incidental Mutations

Incidental Mutation 'R4359:Rasgrf2'

324829

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

041670-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.187) question?

Stock #

R4359 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 91890677 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 1017 (D1017Y)

Ref Sequence

ENSEMBL: ENSMUSP00000096930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099326
AA Change: D1017Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: D1017Y

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000151408
AA Change: D416Y

SMART Domains

Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: D416Y

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
RasGEFN	186	323	6.04e-9	SMART
RasGEF	349	586	2.97e-112	SMART

Meta Mutation Damage Score

0.2802

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	A	T	11: 29,824,669	S263T	probably benign	Het
Abca13	G	T	11: 9,297,629	V2459F	probably benign	Het
Acot1	T	C	12: 84,014,540	Y207H	probably damaging	Het
Anapc1	A	G	2: 128,623,556	V1668A	possibly damaging	Het
Atr	T	A	9: 95,951,536	I2613N	probably damaging	Het
Baz2b	A	G	2: 59,901,613	I2027T	possibly damaging	Het
C2cd3	T	G	7: 100,441,089	H466Q	probably damaging	Het
Cdc14b	T	A	13: 64,248,411	I15F	probably benign	Het
Cep135	G	T	5: 76,611,714	K438N	possibly damaging	Het
Cnot1	T	C	8: 95,739,848	D1587G	probably damaging	Het
Cxcl16	C	A	11: 70,458,805	V65L	possibly damaging	Het
Dhx36	T	A	3: 62,475,278	T783S	probably benign	Het
Disp3	T	C	4: 148,271,932	N157S	probably benign	Het
Gfod2	T	C	8: 105,717,545	N122S	possibly damaging	Het
Gm11639	G	T	11: 104,733,721		probably null	Het
Grin3b	T	A	10: 79,972,897	D160E	probably benign	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Htr1b	C	A	9: 81,632,351	A68S	probably benign	Het
Ifit2	A	T	19: 34,573,144	D28V	possibly damaging	Het
Ifna15	G	T	4: 88,557,842	T135N	probably benign	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
Kif24	A	G	4: 41,413,827		probably null	Het
Klhl25	T	C	7: 75,866,732	V462A	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
L3mbtl3	A	G	10: 26,327,741	V397A	unknown	Het
Lpcat2	C	A	8: 92,873,106	P234Q	probably benign	Het
Lrp1b	A	C	2: 40,903,065	C2532W	probably damaging	Het
Malt1	T	C	18: 65,476,229	V768A	probably benign	Het
Mindy3	A	T	2: 12,396,209	W233R	probably damaging	Het
Ncor1	T	C	11: 62,358,910	K1054R	probably damaging	Het
Nin	T	A	12: 70,014,938	T2051S	probably benign	Het
Olfr16	C	A	1: 172,957,080	A95E	probably benign	Het
Olfr616	A	G	7: 103,564,535	F248S	probably benign	Het
Pcsk1	T	C	13: 75,112,719	S354P	possibly damaging	Het
Pilra	T	C	5: 137,831,314	T160A	probably benign	Het
Plekha5	G	C	6: 140,591,688	E540D	probably benign	Het
Prps2	T	A	X: 167,363,549	K176*	probably null	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Spsb1	T	C	4: 149,906,775	H112R	probably damaging	Het
Srd5a3	T	A	5: 76,147,700	F79Y	probably damaging	Het
Stxbp4	C	T	11: 90,494,644	W506*	probably null	Het
Timeless	C	A	10: 128,247,342	Q653K	probably benign	Het
Trio	G	A	15: 27,749,797	Q1129*	probably null	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Zzef1	T	A	11: 72,823,508	S275T	probably damaging	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	91919817	splice site	probably benign
R0632:Rasgrf2	UTSW	13	91972274	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	91983676	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	91902629	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92030788	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92038281	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92023682	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92029101	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	91884518	nonsense	probably null
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTAGCACTATTCATCGAGGCTCTC -3'
(R):5'- CAAAGATGGACTGAGGGCTTTG -3'

Sequencing Primer
(F):5'- TCAGCAGCAAGGTGTGTCATC -3'
(R):5'- ACTGAGGGCTTTGTACCACTTAGC -3'

Posted On

2015-07-06