Mutagenetix > Incidental Mutations

Incidental Mutation 'R4359:Trio'

324831

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

041670-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4359 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 27749797 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1129 (Q1129*)

Ref Sequence

ENSEMBL: ENSMUSP00000154309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644]

Predicted Effect

probably null
Transcript: ENSMUST00000090247
AA Change: Q2273*

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: Q2273*

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000226644
AA Change: Q1129*

Predicted Effect

probably benign
Transcript: ENSMUST00000227030

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	A	T	11: 29,824,669	S263T	probably benign	Het
Abca13	G	T	11: 9,297,629	V2459F	probably benign	Het
Acot1	T	C	12: 84,014,540	Y207H	probably damaging	Het
Anapc1	A	G	2: 128,623,556	V1668A	possibly damaging	Het
Atr	T	A	9: 95,951,536	I2613N	probably damaging	Het
Baz2b	A	G	2: 59,901,613	I2027T	possibly damaging	Het
C2cd3	T	G	7: 100,441,089	H466Q	probably damaging	Het
Cdc14b	T	A	13: 64,248,411	I15F	probably benign	Het
Cep135	G	T	5: 76,611,714	K438N	possibly damaging	Het
Cnot1	T	C	8: 95,739,848	D1587G	probably damaging	Het
Cxcl16	C	A	11: 70,458,805	V65L	possibly damaging	Het
Dhx36	T	A	3: 62,475,278	T783S	probably benign	Het
Disp3	T	C	4: 148,271,932	N157S	probably benign	Het
Gfod2	T	C	8: 105,717,545	N122S	possibly damaging	Het
Gm11639	G	T	11: 104,733,721		probably null	Het
Grin3b	T	A	10: 79,972,897	D160E	probably benign	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Htr1b	C	A	9: 81,632,351	A68S	probably benign	Het
Ifit2	A	T	19: 34,573,144	D28V	possibly damaging	Het
Ifna15	G	T	4: 88,557,842	T135N	probably benign	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
Kif24	A	G	4: 41,413,827		probably null	Het
Klhl25	T	C	7: 75,866,732	V462A	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
L3mbtl3	A	G	10: 26,327,741	V397A	unknown	Het
Lpcat2	C	A	8: 92,873,106	P234Q	probably benign	Het
Lrp1b	A	C	2: 40,903,065	C2532W	probably damaging	Het
Malt1	T	C	18: 65,476,229	V768A	probably benign	Het
Mindy3	A	T	2: 12,396,209	W233R	probably damaging	Het
Ncor1	T	C	11: 62,358,910	K1054R	probably damaging	Het
Nin	T	A	12: 70,014,938	T2051S	probably benign	Het
Olfr16	C	A	1: 172,957,080	A95E	probably benign	Het
Olfr616	A	G	7: 103,564,535	F248S	probably benign	Het
Pcsk1	T	C	13: 75,112,719	S354P	possibly damaging	Het
Pilra	T	C	5: 137,831,314	T160A	probably benign	Het
Plekha5	G	C	6: 140,591,688	E540D	probably benign	Het
Prps2	T	A	X: 167,363,549	K176*	probably null	Het
Rasgrf2	C	A	13: 91,890,677	D1017Y	probably damaging	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Spsb1	T	C	4: 149,906,775	H112R	probably damaging	Het
Srd5a3	T	A	5: 76,147,700	F79Y	probably damaging	Het
Stxbp4	C	T	11: 90,494,644	W506*	probably null	Het
Timeless	C	A	10: 128,247,342	Q653K	probably benign	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Zzef1	T	A	11: 72,823,508	S275T	probably damaging	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAATGCATCTCGAGGAACGC -3'
(R):5'- ACGACTTGCTGTTTTAAAGGTG -3'

Sequencing Primer
(F):5'- TCTCGAGGAACGCTCAATG -3'
(R):5'- AAAGGTGAGTTGCCTCTGC -3'

Posted On

2015-07-06