Incidental Mutation 'R4359:Ifit2'
ID324834
Institutional Source Beutler Lab
Gene Symbol Ifit2
Ensembl Gene ENSMUSG00000045932
Gene Nameinterferon-induced protein with tetratricopeptide repeats 2
SynonymsIfi54
MMRRC Submission 041670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4359 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34550694-34576419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34573144 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 28 (D28V)
Ref Sequence ENSEMBL: ENSMUSP00000120411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102826] [ENSMUST00000149829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102826
AA Change: D28V

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099890
Gene: ENSMUSG00000045932
AA Change: D28V

DomainStartEndE-ValueType
Pfam:TPR_2 95 127 4e-4 PFAM
Pfam:TPR_8 95 127 3.8e-4 PFAM
Blast:TPR 138 171 7e-11 BLAST
Blast:TPR 172 208 2e-9 BLAST
low complexity region 211 222 N/A INTRINSIC
Pfam:TPR_19 225 286 4e-8 PFAM
low complexity region 396 406 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000149829
AA Change: D28V

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susuceptibility to VSV infection with increased lethality and brain viral titer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A T 11: 29,824,669 S263T probably benign Het
Abca13 G T 11: 9,297,629 V2459F probably benign Het
Acot1 T C 12: 84,014,540 Y207H probably damaging Het
Anapc1 A G 2: 128,623,556 V1668A possibly damaging Het
Atr T A 9: 95,951,536 I2613N probably damaging Het
Baz2b A G 2: 59,901,613 I2027T possibly damaging Het
C2cd3 T G 7: 100,441,089 H466Q probably damaging Het
Cdc14b T A 13: 64,248,411 I15F probably benign Het
Cep135 G T 5: 76,611,714 K438N possibly damaging Het
Cnot1 T C 8: 95,739,848 D1587G probably damaging Het
Cxcl16 C A 11: 70,458,805 V65L possibly damaging Het
Dhx36 T A 3: 62,475,278 T783S probably benign Het
Disp3 T C 4: 148,271,932 N157S probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm11639 G T 11: 104,733,721 probably null Het
Grin3b T A 10: 79,972,897 D160E probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Htr1b C A 9: 81,632,351 A68S probably benign Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
L3mbtl3 A G 10: 26,327,741 V397A unknown Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp1b A C 2: 40,903,065 C2532W probably damaging Het
Malt1 T C 18: 65,476,229 V768A probably benign Het
Mindy3 A T 2: 12,396,209 W233R probably damaging Het
Ncor1 T C 11: 62,358,910 K1054R probably damaging Het
Nin T A 12: 70,014,938 T2051S probably benign Het
Olfr16 C A 1: 172,957,080 A95E probably benign Het
Olfr616 A G 7: 103,564,535 F248S probably benign Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pilra T C 5: 137,831,314 T160A probably benign Het
Plekha5 G C 6: 140,591,688 E540D probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Stxbp4 C T 11: 90,494,644 W506* probably null Het
Timeless C A 10: 128,247,342 Q653K probably benign Het
Trio G A 15: 27,749,797 Q1129* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zzef1 T A 11: 72,823,508 S275T probably damaging Het
Other mutations in Ifit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ifit2 APN 19 34573302 missense probably damaging 1.00
IGL02261:Ifit2 APN 19 34574224 missense probably damaging 1.00
IGL02375:Ifit2 APN 19 34574337 missense probably benign 0.01
Pushup UTSW 19 34574045 missense probably benign 0.38
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0682:Ifit2 UTSW 19 34573612 missense probably benign 0.13
R0927:Ifit2 UTSW 19 34573584 missense probably benign 0.03
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1526:Ifit2 UTSW 19 34573202 missense probably benign 0.00
R2084:Ifit2 UTSW 19 34573350 missense probably damaging 1.00
R3971:Ifit2 UTSW 19 34574041 missense probably benign 0.00
R4008:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4010:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4011:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R5179:Ifit2 UTSW 19 34573576 missense probably damaging 1.00
R5240:Ifit2 UTSW 19 34574396 missense probably benign 0.02
R5424:Ifit2 UTSW 19 34574058 missense probably benign 0.19
R5528:Ifit2 UTSW 19 34573537 missense possibly damaging 0.63
R6605:Ifit2 UTSW 19 34573497 nonsense probably null
R7172:Ifit2 UTSW 19 34573494 missense probably benign 0.24
R7424:Ifit2 UTSW 19 34573198 missense probably benign 0.37
R8090:Ifit2 UTSW 19 34573262 missense possibly damaging 0.70
X0023:Ifit2 UTSW 19 34574250 missense possibly damaging 0.59
X0064:Ifit2 UTSW 19 34573923 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGAGAAGAAGATCCCCTGTGATC -3'
(R):5'- GACCCAAGCATAGTTTCCCCAG -3'

Sequencing Primer
(F):5'- ATCTCACTCTTTGCCAGGTGAACAG -3'
(R):5'- AGCATAGTTTCCCCAGGTGAC -3'
Posted On2015-07-06