Incidental Mutation 'R4360:Psmd1'
ID 324838
Institutional Source Beutler Lab
Gene Symbol Psmd1
Ensembl Gene ENSMUSG00000026229
Gene Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Synonyms P112, S1
MMRRC Submission 041111-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R4360 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 85992341-86067017 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86061459 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 890 (K890E)
Ref Sequence ENSEMBL: ENSMUSP00000027432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027432] [ENSMUST00000139715]
AlphaFold Q3TXS7
Predicted Effect probably damaging
Transcript: ENSMUST00000027432
AA Change: K890E

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027432
Gene: ENSMUSG00000026229
AA Change: K890E

DomainStartEndE-ValueType
Pfam:PC_rep 441 474 5.1e-9 PFAM
Pfam:PC_rep 476 510 8.4e-8 PFAM
Pfam:PC_rep 511 545 1.1e-7 PFAM
Pfam:HEAT_2 599 693 3.3e-15 PFAM
Pfam:PC_rep 651 685 1.1e-11 PFAM
low complexity region 818 828 N/A INTRINSIC
low complexity region 837 872 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135197
AA Change: K34E
Predicted Effect probably benign
Transcript: ENSMUST00000139715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152184
Meta Mutation Damage Score 0.2853 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: In eukaryotic cells, most proteins in the cytosol and nucleus are degraded via the ubiquitin-proteasome pathway. The 26S proteasome is a self-compartmentalizing protease comprised of approximately 31 different subunits. It contains a barrel-shaped proteolytic core complex (the 20S proteasome), capped at one or both ends by 19S regulatory complexes, which recognize ubiquitinated proteins. Protein degradation by proteasomes is the source of most antigenic peptides presented on MHC class I molecules. This gene encodes a non-ATPase subunit of the 26S proteasome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 67,175,850 (GRCm39) noncoding transcript Het
Adgra3 T C 5: 50,147,552 (GRCm39) E496G possibly damaging Het
Atg14 C G 14: 47,805,827 (GRCm39) E13Q probably benign Het
BC023105 G T 18: 60,575,073 (GRCm39) noncoding transcript Het
Chd6 A G 2: 160,791,776 (GRCm39) V2527A possibly damaging Het
Csn1s2a G T 5: 87,929,700 (GRCm39) V100L possibly damaging Het
Fah G A 7: 84,238,856 (GRCm39) L330F probably damaging Het
Fmo2 T C 1: 162,709,583 (GRCm39) N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,431,475 (GRCm39) probably benign Het
Frmd4a A T 2: 4,606,052 (GRCm39) H287L probably damaging Het
G2e3 T A 12: 51,410,197 (GRCm39) probably benign Het
Gm1758 A T 16: 14,324,215 (GRCm39) noncoding transcript Het
Gm7204 T C 16: 48,039,196 (GRCm39) noncoding transcript Het
Gm829 T C 4: 45,718,819 (GRCm39) noncoding transcript Het
Hspa14 A G 2: 3,503,560 (GRCm39) V116A possibly damaging Het
Hspa4 T C 11: 53,155,919 (GRCm39) Y662C probably damaging Het
Islr T A 9: 58,064,887 (GRCm39) N207Y probably damaging Het
Lipc T C 9: 70,759,864 (GRCm39) probably benign Het
Ncor2 A G 5: 125,106,036 (GRCm39) S1546P probably damaging Het
Or13a25 T C 7: 140,247,730 (GRCm39) F170L probably damaging Het
Or56a3 A C 7: 104,735,460 (GRCm39) E179A probably damaging Het
Or7g18 G A 9: 18,787,013 (GRCm39) C127Y probably damaging Het
Parp4 A G 14: 56,866,661 (GRCm39) D1075G possibly damaging Het
Pkp2 A G 16: 16,086,546 (GRCm39) I736V probably benign Het
Plekha8 T C 6: 54,599,171 (GRCm39) I235T probably benign Het
Polq A G 16: 36,880,701 (GRCm39) D955G probably benign Het
Pramel16 A G 4: 143,677,433 (GRCm39) F49L possibly damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scpep1 A G 11: 88,821,070 (GRCm39) Y366H possibly damaging Het
Slc18a3 A G 14: 32,185,882 (GRCm39) V167A probably benign Het
Sp8 A G 12: 118,812,400 (GRCm39) D85G possibly damaging Het
Stard3nl G A 13: 19,554,654 (GRCm39) S144L probably damaging Het
Stk4 A G 2: 163,930,879 (GRCm39) E160G possibly damaging Het
Tbcb T C 7: 29,926,460 (GRCm39) N119S probably benign Het
Tnc G T 4: 63,935,161 (GRCm39) R592S probably benign Het
Trem3 T A 17: 48,556,801 (GRCm39) S91T probably benign Het
Trpc6 A G 9: 8,610,267 (GRCm39) E245G probably benign Het
Usp40 C T 1: 87,880,083 (GRCm39) R1036H probably damaging Het
Usp47 G T 7: 111,654,139 (GRCm39) G112C probably damaging Het
Wdr35 T C 12: 9,024,149 (GRCm39) probably benign Het
Zc3h14 A G 12: 98,746,456 (GRCm39) K555R probably benign Het
Zfp26 T C 9: 20,349,869 (GRCm39) S232G probably benign Het
Zfp811 T C 17: 33,017,432 (GRCm39) T202A probably benign Het
Other mutations in Psmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Psmd1 APN 1 86,017,920 (GRCm39) splice site probably benign
IGL02410:Psmd1 APN 1 86,005,159 (GRCm39) missense probably damaging 0.97
IGL02455:Psmd1 APN 1 86,006,302 (GRCm39) missense probably damaging 0.97
IGL03015:Psmd1 APN 1 86,055,914 (GRCm39) missense probably damaging 0.97
IGL03100:Psmd1 APN 1 86,046,243 (GRCm39) missense possibly damaging 0.68
Neutralized UTSW 1 86,012,914 (GRCm39) missense probably damaging 0.98
Rickety UTSW 1 85,998,350 (GRCm39) critical splice donor site probably null
PIT4480001:Psmd1 UTSW 1 86,055,960 (GRCm39) missense probably damaging 0.99
R0027:Psmd1 UTSW 1 86,021,987 (GRCm39) splice site probably benign
R0115:Psmd1 UTSW 1 86,010,993 (GRCm39) missense possibly damaging 0.89
R0201:Psmd1 UTSW 1 86,046,338 (GRCm39) missense probably benign 0.11
R0206:Psmd1 UTSW 1 86,061,463 (GRCm39) missense possibly damaging 0.94
R0208:Psmd1 UTSW 1 86,061,463 (GRCm39) missense possibly damaging 0.94
R0255:Psmd1 UTSW 1 86,006,304 (GRCm39) missense probably damaging 1.00
R0486:Psmd1 UTSW 1 86,022,012 (GRCm39) missense probably damaging 0.99
R0675:Psmd1 UTSW 1 86,009,761 (GRCm39) missense probably benign 0.03
R0790:Psmd1 UTSW 1 86,005,172 (GRCm39) missense possibly damaging 0.94
R1565:Psmd1 UTSW 1 86,019,719 (GRCm39) splice site probably benign
R1721:Psmd1 UTSW 1 85,999,567 (GRCm39) missense probably damaging 0.99
R2010:Psmd1 UTSW 1 86,003,719 (GRCm39) missense probably damaging 0.96
R2098:Psmd1 UTSW 1 86,009,823 (GRCm39) splice site probably null
R2118:Psmd1 UTSW 1 86,006,422 (GRCm39) missense possibly damaging 0.94
R2119:Psmd1 UTSW 1 86,006,422 (GRCm39) missense possibly damaging 0.94
R2120:Psmd1 UTSW 1 86,006,422 (GRCm39) missense possibly damaging 0.94
R2122:Psmd1 UTSW 1 86,006,422 (GRCm39) missense possibly damaging 0.94
R2504:Psmd1 UTSW 1 86,017,719 (GRCm39) missense possibly damaging 0.91
R3810:Psmd1 UTSW 1 86,060,437 (GRCm39) missense probably damaging 0.99
R3811:Psmd1 UTSW 1 86,060,437 (GRCm39) missense probably damaging 0.99
R3978:Psmd1 UTSW 1 86,055,909 (GRCm39) missense probably benign 0.05
R4131:Psmd1 UTSW 1 86,006,422 (GRCm39) missense probably damaging 0.98
R4386:Psmd1 UTSW 1 86,055,914 (GRCm39) missense possibly damaging 0.93
R4402:Psmd1 UTSW 1 86,003,673 (GRCm39) missense possibly damaging 0.59
R4591:Psmd1 UTSW 1 86,055,926 (GRCm39) missense probably benign 0.05
R4783:Psmd1 UTSW 1 86,006,434 (GRCm39) missense probably damaging 0.97
R4824:Psmd1 UTSW 1 86,064,820 (GRCm39) missense probably benign 0.08
R4937:Psmd1 UTSW 1 86,010,947 (GRCm39) missense probably damaging 0.98
R5443:Psmd1 UTSW 1 86,017,905 (GRCm39) missense probably damaging 0.99
R5486:Psmd1 UTSW 1 86,064,772 (GRCm39) missense possibly damaging 0.59
R5979:Psmd1 UTSW 1 86,017,775 (GRCm39) missense possibly damaging 0.92
R6033:Psmd1 UTSW 1 86,064,817 (GRCm39) missense probably damaging 1.00
R6425:Psmd1 UTSW 1 85,998,350 (GRCm39) critical splice donor site probably null
R7467:Psmd1 UTSW 1 86,044,355 (GRCm39) missense probably damaging 0.99
R8257:Psmd1 UTSW 1 86,006,345 (GRCm39) missense probably damaging 0.99
R8390:Psmd1 UTSW 1 86,006,329 (GRCm39) missense possibly damaging 0.59
R8750:Psmd1 UTSW 1 86,016,585 (GRCm39) missense probably damaging 0.99
R8890:Psmd1 UTSW 1 86,012,914 (GRCm39) missense probably damaging 0.98
R9017:Psmd1 UTSW 1 86,054,231 (GRCm39) missense probably damaging 0.99
R9142:Psmd1 UTSW 1 86,064,817 (GRCm39) missense probably damaging 1.00
R9330:Psmd1 UTSW 1 86,061,490 (GRCm39) missense probably damaging 1.00
R9799:Psmd1 UTSW 1 86,054,236 (GRCm39) missense possibly damaging 0.77
Z1177:Psmd1 UTSW 1 86,010,890 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCACCTGACAGTGTTCTAGAAAC -3'
(R):5'- CAAGGAGATGGCGATCACTC -3'

Sequencing Primer
(F):5'- CCTGACAGTGTTCTAGAAACTTAGC -3'
(R):5'- GATCACTCTTGTTTTTGCTAGCAG -3'
Posted On 2015-07-06