Incidental Mutation 'R4360:Usp40'
Institutional Source Beutler Lab
Gene Symbol Usp40
Ensembl Gene ENSMUSG00000005501
Gene Nameubiquitin specific peptidase 40
MMRRC Submission 041111-MU
Accession Numbers

Genbank: NM_001033291

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4360 (G1)
Quality Score143
Status Validated
Chromosomal Location87945119-88008551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87952361 bp
Amino Acid Change Arginine to Histidine at position 1036 (R1036H)
Ref Sequence ENSEMBL: ENSMUSP00000140107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040783] [ENSMUST00000187758] [ENSMUST00000188332]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040783
AA Change: R947H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038533
Gene: ENSMUSG00000005501
AA Change: R947H

Pfam:UCH 40 344 1.1e-31 PFAM
Pfam:UCH_1 41 320 1.2e-20 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186670
Predicted Effect probably damaging
Transcript: ENSMUST00000187758
AA Change: R1036H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140107
Gene: ENSMUSG00000005501
AA Change: R1036H

Pfam:UCH 40 346 8.7e-41 PFAM
Pfam:UCH_1 41 319 2.4e-22 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188332
SMART Domains Protein: ENSMUSP00000140574
Gene: ENSMUSG00000005501

Pfam:UCH 40 70 5.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189409
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP40 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Usp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Usp40 APN 1 88004238 splice site probably benign
IGL00828:Usp40 APN 1 87978306 unclassified probably benign
IGL01090:Usp40 APN 1 87962465 missense probably benign 0.01
IGL01123:Usp40 APN 1 87986123 missense probably benign 0.01
IGL01401:Usp40 APN 1 87994198 missense probably damaging 1.00
IGL02506:Usp40 APN 1 87982016 missense probably damaging 0.98
IGL02580:Usp40 APN 1 87980966 splice site probably null
IGL02625:Usp40 APN 1 87950017 missense probably benign 0.19
IGL02811:Usp40 APN 1 87995736 missense probably damaging 1.00
IGL02958:Usp40 APN 1 87978485 missense probably damaging 0.99
G5030:Usp40 UTSW 1 87994219 missense probably damaging 1.00
R0019:Usp40 UTSW 1 87978411 missense probably benign 0.00
R0282:Usp40 UTSW 1 87980958 splice site probably benign
R0453:Usp40 UTSW 1 87946598 makesense probably null
R0646:Usp40 UTSW 1 87978522 missense probably benign 0.00
R1440:Usp40 UTSW 1 87982086 missense probably benign 0.01
R1490:Usp40 UTSW 1 87988965 nonsense probably null
R1620:Usp40 UTSW 1 87994225 missense probably damaging 1.00
R1881:Usp40 UTSW 1 87994271 missense probably benign 0.08
R1903:Usp40 UTSW 1 87982056 missense probably benign 0.15
R1912:Usp40 UTSW 1 87946646 missense probably benign 0.00
R1919:Usp40 UTSW 1 87995842 missense possibly damaging 0.75
R1976:Usp40 UTSW 1 87978536 missense probably benign 0.00
R2111:Usp40 UTSW 1 87950214 missense probably benign 0.17
R2112:Usp40 UTSW 1 87950214 missense probably benign 0.17
R2163:Usp40 UTSW 1 87995858 splice site probably benign
R2432:Usp40 UTSW 1 87982082 missense probably benign
R2865:Usp40 UTSW 1 87949979 nonsense probably null
R3885:Usp40 UTSW 1 87967269 missense probably damaging 1.00
R4370:Usp40 UTSW 1 87997875 missense probably benign
R4496:Usp40 UTSW 1 87995737 missense possibly damaging 0.69
R4714:Usp40 UTSW 1 87967179 splice site probably null
R4888:Usp40 UTSW 1 87986201 critical splice acceptor site probably null
R4944:Usp40 UTSW 1 87952355 missense probably benign 0.10
R5269:Usp40 UTSW 1 87995782 missense probably benign 0.01
R5629:Usp40 UTSW 1 87981009 missense probably benign
R5696:Usp40 UTSW 1 87995752 missense probably benign 0.27
R5756:Usp40 UTSW 1 87951691 missense possibly damaging 0.66
R5887:Usp40 UTSW 1 87999870 missense probably damaging 1.00
R5910:Usp40 UTSW 1 87968400 nonsense probably null
R6014:Usp40 UTSW 1 87980016 missense probably damaging 1.00
R6044:Usp40 UTSW 1 87990150 missense probably benign
R6083:Usp40 UTSW 1 87978559 missense probably benign 0.01
R6299:Usp40 UTSW 1 87997927 missense probably damaging 0.99
R6625:Usp40 UTSW 1 87967213 missense probably benign 0.01
R6757:Usp40 UTSW 1 87980037 missense probably damaging 0.99
R6810:Usp40 UTSW 1 87981033 missense probably benign 0.11
R7110:Usp40 UTSW 1 87986162 missense probably benign 0.11
R7573:Usp40 UTSW 1 87986072 missense probably benign 0.09
R7575:Usp40 UTSW 1 87949960 missense probably damaging 1.00
R7634:Usp40 UTSW 1 87962430 nonsense probably null
R7756:Usp40 UTSW 1 87967200 missense probably damaging 0.99
R7767:Usp40 UTSW 1 87982178 missense probably benign 0.01
R7861:Usp40 UTSW 1 87982130 missense probably damaging 0.99
R7881:Usp40 UTSW 1 87995713 nonsense probably null
R7896:Usp40 UTSW 1 87978479 missense possibly damaging 0.77
R7944:Usp40 UTSW 1 87982130 missense probably damaging 0.99
R7964:Usp40 UTSW 1 87995713 nonsense probably null
R7979:Usp40 UTSW 1 87978479 missense possibly damaging 0.77
RF006:Usp40 UTSW 1 87967195 missense possibly damaging 0.47
Z1177:Usp40 UTSW 1 87968414 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-06