Incidental Mutation 'R4360:Fmo2'
ID324840
Institutional Source Beutler Lab
Gene Symbol Fmo2
Ensembl Gene ENSMUSG00000040170
Gene Nameflavin containing monooxygenase 2
Synonyms2310008D08Rik, 2310042I22Rik
MMRRC Submission 041111-MU
Accession Numbers

Genbank: NM_018881

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4360 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162874317-162898726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 162882014 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 268 (N268S)
Ref Sequence ENSEMBL: ENSMUSP00000107135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045902] [ENSMUST00000111510]
Predicted Effect probably damaging
Transcript: ENSMUST00000045902
AA Change: N268S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044405
Gene: ENSMUSG00000040170
AA Change: N268S

DomainStartEndE-ValueType
Pfam:FMO-like 2 533 8.7e-296 PFAM
Pfam:Pyr_redox_2 3 230 6.4e-12 PFAM
Pfam:Pyr_redox_3 6 220 4.4e-10 PFAM
Pfam:K_oxygenase 69 233 2.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111510
AA Change: N268S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107135
Gene: ENSMUSG00000040170
AA Change: N268S

DomainStartEndE-ValueType
Pfam:FMO-like 2 533 8.7e-296 PFAM
Pfam:Pyr_redox_2 4 446 1.3e-6 PFAM
Pfam:Pyr_redox_3 6 220 8e-17 PFAM
Pfam:NAD_binding_8 7 72 4.3e-6 PFAM
Pfam:K_oxygenase 78 333 1.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194197
Meta Mutation Damage Score 0.1474 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin-containing monooxygenase family member. It is an NADPH-dependent enzyme that catalyzes the N-oxidation of some primary alkylamines through an N-hydroxylamine intermediate. However, some human populations contain an allele (FMO2*2A) with a premature stop codon, resulting in a protein that is C-terminally-truncated, has no catalytic activity, and is likely degraded rapidly. This gene is found in a cluster with other related family members on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Fmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Fmo2 APN 1 162888713 nonsense probably null
IGL01299:Fmo2 APN 1 162878030 missense probably benign
IGL02617:Fmo2 APN 1 162876921 missense probably damaging 1.00
IGL02994:Fmo2 APN 1 162880620 missense probably damaging 1.00
IGL03270:Fmo2 APN 1 162882026 missense probably damaging 1.00
F5493:Fmo2 UTSW 1 162880532 missense probably benign 0.41
R0058:Fmo2 UTSW 1 162886324 missense probably benign 0.38
R0058:Fmo2 UTSW 1 162886324 missense probably benign 0.38
R0501:Fmo2 UTSW 1 162876928 missense probably benign 0.00
R0658:Fmo2 UTSW 1 162876774 missense possibly damaging 0.57
R0800:Fmo2 UTSW 1 162876814 missense probably benign 0.00
R2223:Fmo2 UTSW 1 162898244 missense probably damaging 1.00
R4523:Fmo2 UTSW 1 162887708 missense probably benign 0.44
R4755:Fmo2 UTSW 1 162888805 missense probably damaging 1.00
R6087:Fmo2 UTSW 1 162880433 missense probably benign 0.45
R6219:Fmo2 UTSW 1 162880516 missense probably damaging 0.97
R6668:Fmo2 UTSW 1 162877048 missense probably benign 0.15
R7042:Fmo2 UTSW 1 162880657 missense probably damaging 1.00
R7291:Fmo2 UTSW 1 162887702 missense probably benign 0.06
R7560:Fmo2 UTSW 1 162888749 missense probably damaging 1.00
R7580:Fmo2 UTSW 1 162877044 missense possibly damaging 0.46
R7657:Fmo2 UTSW 1 162888844 missense probably damaging 1.00
Z1176:Fmo2 UTSW 1 162887598 missense probably benign 0.01
Z1176:Fmo2 UTSW 1 162898274 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAATTAGAACTCCAGGATCG -3'
(R):5'- AACACCTTTCATAGCAACTGGTC -3'

Sequencing Primer
(F):5'- GAACTCCAGGATCGATACAATTATAC -3'
(R):5'- GCAACTGGTCAAATTTCACCTG -3'
Posted On2015-07-06