Incidental Mutation 'R4360:Frmd4a'
ID 324842
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene Name FERM domain containing 4A
Synonyms 2700017I06Rik, C230040M21Rik, Gm13190
MMRRC Submission 041111-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R4360 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 4022528-4618854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4606052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 287 (H287L)
Ref Sequence ENSEMBL: ENSMUSP00000134803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000176828] [ENSMUST00000177457]
AlphaFold Q8BIE6
Predicted Effect probably damaging
Transcript: ENSMUST00000075767
AA Change: H581L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657
AA Change: H581L

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091497
AA Change: H592L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657
AA Change: H592L

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153160
Predicted Effect probably damaging
Transcript: ENSMUST00000176828
AA Change: H287L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134803
Gene: ENSMUSG00000026657
AA Change: H287L

DomainStartEndE-ValueType
Pfam:DUF3338 46 183 4.1e-64 PFAM
low complexity region 264 277 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 438 447 N/A INTRINSIC
low complexity region 470 491 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 630 653 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177457
AA Change: H596L

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657
AA Change: H596L

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Meta Mutation Damage Score 0.1221 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 67,175,850 (GRCm39) noncoding transcript Het
Adgra3 T C 5: 50,147,552 (GRCm39) E496G possibly damaging Het
Atg14 C G 14: 47,805,827 (GRCm39) E13Q probably benign Het
BC023105 G T 18: 60,575,073 (GRCm39) noncoding transcript Het
Chd6 A G 2: 160,791,776 (GRCm39) V2527A possibly damaging Het
Csn1s2a G T 5: 87,929,700 (GRCm39) V100L possibly damaging Het
Fah G A 7: 84,238,856 (GRCm39) L330F probably damaging Het
Fmo2 T C 1: 162,709,583 (GRCm39) N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,431,475 (GRCm39) probably benign Het
G2e3 T A 12: 51,410,197 (GRCm39) probably benign Het
Gm1758 A T 16: 14,324,215 (GRCm39) noncoding transcript Het
Gm7204 T C 16: 48,039,196 (GRCm39) noncoding transcript Het
Gm829 T C 4: 45,718,819 (GRCm39) noncoding transcript Het
Hspa14 A G 2: 3,503,560 (GRCm39) V116A possibly damaging Het
Hspa4 T C 11: 53,155,919 (GRCm39) Y662C probably damaging Het
Islr T A 9: 58,064,887 (GRCm39) N207Y probably damaging Het
Lipc T C 9: 70,759,864 (GRCm39) probably benign Het
Ncor2 A G 5: 125,106,036 (GRCm39) S1546P probably damaging Het
Or13a25 T C 7: 140,247,730 (GRCm39) F170L probably damaging Het
Or56a3 A C 7: 104,735,460 (GRCm39) E179A probably damaging Het
Or7g18 G A 9: 18,787,013 (GRCm39) C127Y probably damaging Het
Parp4 A G 14: 56,866,661 (GRCm39) D1075G possibly damaging Het
Pkp2 A G 16: 16,086,546 (GRCm39) I736V probably benign Het
Plekha8 T C 6: 54,599,171 (GRCm39) I235T probably benign Het
Polq A G 16: 36,880,701 (GRCm39) D955G probably benign Het
Pramel16 A G 4: 143,677,433 (GRCm39) F49L possibly damaging Het
Psmd1 A G 1: 86,061,459 (GRCm39) K890E probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scpep1 A G 11: 88,821,070 (GRCm39) Y366H possibly damaging Het
Slc18a3 A G 14: 32,185,882 (GRCm39) V167A probably benign Het
Sp8 A G 12: 118,812,400 (GRCm39) D85G possibly damaging Het
Stard3nl G A 13: 19,554,654 (GRCm39) S144L probably damaging Het
Stk4 A G 2: 163,930,879 (GRCm39) E160G possibly damaging Het
Tbcb T C 7: 29,926,460 (GRCm39) N119S probably benign Het
Tnc G T 4: 63,935,161 (GRCm39) R592S probably benign Het
Trem3 T A 17: 48,556,801 (GRCm39) S91T probably benign Het
Trpc6 A G 9: 8,610,267 (GRCm39) E245G probably benign Het
Usp40 C T 1: 87,880,083 (GRCm39) R1036H probably damaging Het
Usp47 G T 7: 111,654,139 (GRCm39) G112C probably damaging Het
Wdr35 T C 12: 9,024,149 (GRCm39) probably benign Het
Zc3h14 A G 12: 98,746,456 (GRCm39) K555R probably benign Het
Zfp26 T C 9: 20,349,869 (GRCm39) S232G probably benign Het
Zfp811 T C 17: 33,017,432 (GRCm39) T202A probably benign Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4,599,525 (GRCm39) missense probably benign 0.00
IGL00508:Frmd4a APN 2 4,599,545 (GRCm39) nonsense probably null
IGL01331:Frmd4a APN 2 4,607,036 (GRCm39) missense probably benign 0.32
IGL01774:Frmd4a APN 2 4,540,047 (GRCm39) splice site probably benign
IGL01909:Frmd4a APN 2 4,608,844 (GRCm39) missense probably benign 0.11
IGL02170:Frmd4a APN 2 4,570,988 (GRCm39) missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4,609,045 (GRCm39) missense probably benign 0.19
IGL02377:Frmd4a APN 2 4,539,385 (GRCm39) missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4,502,837 (GRCm39) missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4,477,963 (GRCm39) missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4,477,963 (GRCm39) missense probably damaging 1.00
R0081:Frmd4a UTSW 2 4,577,252 (GRCm39) critical splice donor site probably null
R0128:Frmd4a UTSW 2 4,608,903 (GRCm39) missense probably damaging 0.98
R0130:Frmd4a UTSW 2 4,608,903 (GRCm39) missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4,577,198 (GRCm39) missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4,610,834 (GRCm39) missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4,608,778 (GRCm39) missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4,477,999 (GRCm39) missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4,539,997 (GRCm39) missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4,577,176 (GRCm39) missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4,610,834 (GRCm39) missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4,577,210 (GRCm39) frame shift probably null
R2340:Frmd4a UTSW 2 4,591,187 (GRCm39) missense probably damaging 1.00
R2426:Frmd4a UTSW 2 4,534,673 (GRCm39) missense probably damaging 1.00
R2680:Frmd4a UTSW 2 4,539,364 (GRCm39) missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4,157,839 (GRCm39) intron probably benign
R3772:Frmd4a UTSW 2 4,595,433 (GRCm39) missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4,595,433 (GRCm39) missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4,542,071 (GRCm39) missense probably damaging 1.00
R4094:Frmd4a UTSW 2 4,615,843 (GRCm39) missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4,337,889 (GRCm39) missense probably benign 0.00
R4299:Frmd4a UTSW 2 4,337,882 (GRCm39) missense probably benign 0.02
R4304:Frmd4a UTSW 2 4,337,889 (GRCm39) missense probably benign 0.00
R4306:Frmd4a UTSW 2 4,337,889 (GRCm39) missense probably benign 0.00
R4307:Frmd4a UTSW 2 4,337,889 (GRCm39) missense probably benign 0.00
R4346:Frmd4a UTSW 2 4,612,844 (GRCm39) missense possibly damaging 0.92
R4384:Frmd4a UTSW 2 4,599,374 (GRCm39) nonsense probably null
R4547:Frmd4a UTSW 2 4,477,956 (GRCm39) missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4,608,490 (GRCm39) missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4,608,490 (GRCm39) missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4,608,490 (GRCm39) missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4,542,122 (GRCm39) missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4,608,259 (GRCm39) missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4,606,108 (GRCm39) missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4,534,628 (GRCm39) missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4,608,732 (GRCm39) missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4,599,384 (GRCm39) missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4,305,768 (GRCm39) missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4,488,876 (GRCm39) missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4,337,927 (GRCm39) missense probably benign 0.02
R5932:Frmd4a UTSW 2 4,534,650 (GRCm39) missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4,607,060 (GRCm39) missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4,595,509 (GRCm39) missense probably damaging 0.99
R6622:Frmd4a UTSW 2 4,610,873 (GRCm39) missense probably benign 0.00
R6903:Frmd4a UTSW 2 4,591,267 (GRCm39) missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4,570,923 (GRCm39)
R7098:Frmd4a UTSW 2 4,577,244 (GRCm39) missense probably damaging 1.00
R7258:Frmd4a UTSW 2 4,305,764 (GRCm39) missense probably benign
R7336:Frmd4a UTSW 2 4,478,025 (GRCm39) missense possibly damaging 0.92
R7582:Frmd4a UTSW 2 4,599,408 (GRCm39) frame shift probably null
R7607:Frmd4a UTSW 2 4,596,747 (GRCm39) nonsense probably null
R7697:Frmd4a UTSW 2 4,488,892 (GRCm39) missense probably damaging 1.00
R7750:Frmd4a UTSW 2 4,606,160 (GRCm39) missense probably benign 0.14
R7795:Frmd4a UTSW 2 4,595,506 (GRCm39) missense probably damaging 1.00
R7848:Frmd4a UTSW 2 4,596,728 (GRCm39) intron probably benign
R7899:Frmd4a UTSW 2 4,608,900 (GRCm39) missense probably damaging 1.00
R8024:Frmd4a UTSW 2 4,608,513 (GRCm39) missense probably damaging 1.00
R8399:Frmd4a UTSW 2 4,577,244 (GRCm39) missense probably damaging 1.00
R8778:Frmd4a UTSW 2 4,478,026 (GRCm39) missense probably damaging 1.00
R8876:Frmd4a UTSW 2 4,606,111 (GRCm39) missense probably damaging 0.99
R9074:Frmd4a UTSW 2 4,608,765 (GRCm39) missense probably damaging 1.00
R9075:Frmd4a UTSW 2 4,608,765 (GRCm39) missense probably damaging 1.00
R9076:Frmd4a UTSW 2 4,608,765 (GRCm39) missense probably damaging 1.00
R9105:Frmd4a UTSW 2 4,539,994 (GRCm39) missense probably damaging 0.96
R9213:Frmd4a UTSW 2 4,608,372 (GRCm39) missense probably damaging 1.00
R9227:Frmd4a UTSW 2 4,612,844 (GRCm39) missense possibly damaging 0.92
R9230:Frmd4a UTSW 2 4,612,844 (GRCm39) missense possibly damaging 0.92
R9235:Frmd4a UTSW 2 4,599,366 (GRCm39) missense probably damaging 0.99
R9266:Frmd4a UTSW 2 4,610,846 (GRCm39) missense probably damaging 0.99
R9301:Frmd4a UTSW 2 4,157,904 (GRCm39) missense probably benign 0.27
R9307:Frmd4a UTSW 2 4,609,044 (GRCm39) missense probably benign
R9365:Frmd4a UTSW 2 4,606,973 (GRCm39) missense probably benign 0.01
R9476:Frmd4a UTSW 2 4,608,324 (GRCm39) missense probably benign 0.32
R9484:Frmd4a UTSW 2 4,609,026 (GRCm39) missense possibly damaging 0.49
R9510:Frmd4a UTSW 2 4,608,324 (GRCm39) missense probably benign 0.32
R9513:Frmd4a UTSW 2 4,608,711 (GRCm39) missense probably damaging 0.99
Z1176:Frmd4a UTSW 2 4,502,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTCCAAGGCACTGACATG -3'
(R):5'- CAAGCCTTTGATTCTGTTTGAGC -3'

Sequencing Primer
(F):5'- GCAAAGGCTCCATCTCTTGTGG -3'
(R):5'- CTGTTTGAGCATATCCGGGGAC -3'
Posted On 2015-07-06