Incidental Mutation 'R4360:Pramef25'
ID324847
Institutional Source Beutler Lab
Gene Symbol Pramef25
Ensembl Gene ENSMUSG00000078511
Gene NamePRAME family member 25
SynonymsGm13109
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4360 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143948580-143951016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143950863 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 49 (F49L)
Ref Sequence ENSEMBL: ENSMUSP00000101392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105766]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105766
AA Change: F49L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101392
Gene: ENSMUSG00000078511
AA Change: F49L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 427 2e-10 SMART
Meta Mutation Damage Score 0.3366 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Pramef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Pramef25 APN 4 143950214 splice site probably benign
IGL01562:Pramef25 APN 4 143950865 missense probably damaging 1.00
IGL02422:Pramef25 APN 4 143949883 missense probably benign 0.25
IGL02632:Pramef25 APN 4 143949937 missense possibly damaging 0.84
IGL02745:Pramef25 APN 4 143950724 missense probably damaging 1.00
IGL02808:Pramef25 APN 4 143951015 utr 5 prime probably benign
IGL02883:Pramef25 APN 4 143949848 missense possibly damaging 0.64
IGL02961:Pramef25 APN 4 143949147 missense probably damaging 1.00
IGL03092:Pramef25 APN 4 143950197 missense probably damaging 0.97
FR4340:Pramef25 UTSW 4 143949742 missense probably damaging 0.99
FR4342:Pramef25 UTSW 4 143949742 missense probably damaging 0.99
FR4342:Pramef25 UTSW 4 143949757 frame shift probably null
R0533:Pramef25 UTSW 4 143950720 missense possibly damaging 0.85
R0606:Pramef25 UTSW 4 143949883 missense probably benign 0.25
R1624:Pramef25 UTSW 4 143949830 missense possibly damaging 0.47
R1898:Pramef25 UTSW 4 143950728 missense probably damaging 1.00
R2029:Pramef25 UTSW 4 143949883 missense probably benign 0.25
R2867:Pramef25 UTSW 4 143948886 missense probably benign 0.00
R2867:Pramef25 UTSW 4 143948886 missense probably benign 0.00
R2894:Pramef25 UTSW 4 143949122 missense probably damaging 1.00
R4111:Pramef25 UTSW 4 143949905 missense possibly damaging 0.93
R4298:Pramef25 UTSW 4 143949143 nonsense probably null
R4361:Pramef25 UTSW 4 143950863 missense possibly damaging 0.81
R5137:Pramef25 UTSW 4 143949120 missense probably benign 0.08
R5195:Pramef25 UTSW 4 143950880 missense probably damaging 0.99
R5312:Pramef25 UTSW 4 143949095 missense possibly damaging 0.96
R5548:Pramef25 UTSW 4 143949980 missense probably benign 0.24
R5591:Pramef25 UTSW 4 143948807 missense probably damaging 1.00
R5644:Pramef25 UTSW 4 143948804 missense probably benign 0.01
R6018:Pramef25 UTSW 4 143950899 missense possibly damaging 0.61
R6177:Pramef25 UTSW 4 143949006 missense possibly damaging 0.51
R6335:Pramef25 UTSW 4 143949032 missense probably benign 0.02
R6376:Pramef25 UTSW 4 143950697 missense probably benign 0.03
R6572:Pramef25 UTSW 4 143949692 missense probably benign 0.01
R6845:Pramef25 UTSW 4 143949824 missense probably benign
R6939:Pramef25 UTSW 4 143948796 missense probably benign 0.09
R7081:Pramef25 UTSW 4 143949278 missense probably damaging 1.00
R7505:Pramef25 UTSW 4 143949703 missense possibly damaging 0.94
R7711:Pramef25 UTSW 4 143949252 missense probably benign 0.22
RF011:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
RF013:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
RF021:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
Z1176:Pramef25 UTSW 4 143950123 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTTGGGTGAAAATTTCCTGTCAGC -3'
(R):5'- TCTGGCACTTTGATGGTTCC -3'

Sequencing Primer
(F):5'- GAAAATTTCCTGTCAGCTGCATGTC -3'
(R):5'- GTTCCTTTGATGCAGGCATTTAAAG -3'
Posted On2015-07-06