Incidental Mutation 'R4360:Adgra3'
ID 324848
Institutional Source Beutler Lab
Gene Symbol Adgra3
Ensembl Gene ENSMUSG00000029090
Gene Name adhesion G protein-coupled receptor A3
Synonyms Tem5-like, 3830613O22Rik, Gpr125
MMRRC Submission 041111-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4360 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 50117293-50216338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50147552 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 496 (E496G)
Ref Sequence ENSEMBL: ENSMUSP00000030971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030971]
AlphaFold Q7TT36
Predicted Effect possibly damaging
Transcript: ENSMUST00000030971
AA Change: E496G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: E496G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198818
Meta Mutation Damage Score 0.2244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 67,175,850 (GRCm39) noncoding transcript Het
Atg14 C G 14: 47,805,827 (GRCm39) E13Q probably benign Het
BC023105 G T 18: 60,575,073 (GRCm39) noncoding transcript Het
Chd6 A G 2: 160,791,776 (GRCm39) V2527A possibly damaging Het
Csn1s2a G T 5: 87,929,700 (GRCm39) V100L possibly damaging Het
Fah G A 7: 84,238,856 (GRCm39) L330F probably damaging Het
Fmo2 T C 1: 162,709,583 (GRCm39) N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,431,475 (GRCm39) probably benign Het
Frmd4a A T 2: 4,606,052 (GRCm39) H287L probably damaging Het
G2e3 T A 12: 51,410,197 (GRCm39) probably benign Het
Gm1758 A T 16: 14,324,215 (GRCm39) noncoding transcript Het
Gm7204 T C 16: 48,039,196 (GRCm39) noncoding transcript Het
Gm829 T C 4: 45,718,819 (GRCm39) noncoding transcript Het
Hspa14 A G 2: 3,503,560 (GRCm39) V116A possibly damaging Het
Hspa4 T C 11: 53,155,919 (GRCm39) Y662C probably damaging Het
Islr T A 9: 58,064,887 (GRCm39) N207Y probably damaging Het
Lipc T C 9: 70,759,864 (GRCm39) probably benign Het
Ncor2 A G 5: 125,106,036 (GRCm39) S1546P probably damaging Het
Or13a25 T C 7: 140,247,730 (GRCm39) F170L probably damaging Het
Or56a3 A C 7: 104,735,460 (GRCm39) E179A probably damaging Het
Or7g18 G A 9: 18,787,013 (GRCm39) C127Y probably damaging Het
Parp4 A G 14: 56,866,661 (GRCm39) D1075G possibly damaging Het
Pkp2 A G 16: 16,086,546 (GRCm39) I736V probably benign Het
Plekha8 T C 6: 54,599,171 (GRCm39) I235T probably benign Het
Polq A G 16: 36,880,701 (GRCm39) D955G probably benign Het
Pramel16 A G 4: 143,677,433 (GRCm39) F49L possibly damaging Het
Psmd1 A G 1: 86,061,459 (GRCm39) K890E probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scpep1 A G 11: 88,821,070 (GRCm39) Y366H possibly damaging Het
Slc18a3 A G 14: 32,185,882 (GRCm39) V167A probably benign Het
Sp8 A G 12: 118,812,400 (GRCm39) D85G possibly damaging Het
Stard3nl G A 13: 19,554,654 (GRCm39) S144L probably damaging Het
Stk4 A G 2: 163,930,879 (GRCm39) E160G possibly damaging Het
Tbcb T C 7: 29,926,460 (GRCm39) N119S probably benign Het
Tnc G T 4: 63,935,161 (GRCm39) R592S probably benign Het
Trem3 T A 17: 48,556,801 (GRCm39) S91T probably benign Het
Trpc6 A G 9: 8,610,267 (GRCm39) E245G probably benign Het
Usp40 C T 1: 87,880,083 (GRCm39) R1036H probably damaging Het
Usp47 G T 7: 111,654,139 (GRCm39) G112C probably damaging Het
Wdr35 T C 12: 9,024,149 (GRCm39) probably benign Het
Zc3h14 A G 12: 98,746,456 (GRCm39) K555R probably benign Het
Zfp26 T C 9: 20,349,869 (GRCm39) S232G probably benign Het
Zfp811 T C 17: 33,017,432 (GRCm39) T202A probably benign Het
Other mutations in Adgra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Adgra3 APN 5 50,183,100 (GRCm39) missense probably damaging 1.00
IGL00848:Adgra3 APN 5 50,159,291 (GRCm39) missense probably damaging 1.00
IGL01455:Adgra3 APN 5 50,144,899 (GRCm39) nonsense probably null
IGL01665:Adgra3 APN 5 50,164,272 (GRCm39) missense possibly damaging 0.64
IGL02151:Adgra3 APN 5 50,136,484 (GRCm39) missense probably benign
IGL02239:Adgra3 APN 5 50,118,054 (GRCm39) missense probably damaging 1.00
IGL02351:Adgra3 APN 5 50,215,900 (GRCm39) missense probably benign 0.19
IGL02358:Adgra3 APN 5 50,215,900 (GRCm39) missense probably benign 0.19
IGL02938:Adgra3 APN 5 50,118,659 (GRCm39) missense probably benign 0.01
IGL03028:Adgra3 APN 5 50,174,194 (GRCm39) missense probably benign 0.30
aperture UTSW 5 50,156,487 (GRCm39) nonsense probably null
saltatory UTSW 5 50,117,901 (GRCm39) missense probably benign 0.09
ANU74:Adgra3 UTSW 5 50,118,380 (GRCm39) missense probably benign 0.16
R0041:Adgra3 UTSW 5 50,117,901 (GRCm39) missense probably benign 0.09
R0041:Adgra3 UTSW 5 50,117,901 (GRCm39) missense probably benign 0.09
R0121:Adgra3 UTSW 5 50,183,128 (GRCm39) splice site probably benign
R0125:Adgra3 UTSW 5 50,159,194 (GRCm39) splice site probably benign
R0137:Adgra3 UTSW 5 50,121,182 (GRCm39) splice site probably benign
R0415:Adgra3 UTSW 5 50,119,099 (GRCm39) splice site probably benign
R0479:Adgra3 UTSW 5 50,147,607 (GRCm39) missense probably benign 0.00
R0505:Adgra3 UTSW 5 50,166,676 (GRCm39) critical splice donor site probably null
R0831:Adgra3 UTSW 5 50,128,144 (GRCm39) missense probably damaging 1.00
R0883:Adgra3 UTSW 5 50,118,065 (GRCm39) missense probably damaging 1.00
R0920:Adgra3 UTSW 5 50,118,503 (GRCm39) missense probably benign 0.19
R1139:Adgra3 UTSW 5 50,119,097 (GRCm39) splice site probably null
R1211:Adgra3 UTSW 5 50,164,218 (GRCm39) missense possibly damaging 0.88
R1370:Adgra3 UTSW 5 50,118,129 (GRCm39) missense possibly damaging 0.56
R1530:Adgra3 UTSW 5 50,118,479 (GRCm39) missense probably benign 0.00
R1703:Adgra3 UTSW 5 50,164,117 (GRCm39) missense probably benign 0.00
R1782:Adgra3 UTSW 5 50,129,404 (GRCm39) missense probably benign 0.02
R1843:Adgra3 UTSW 5 50,118,834 (GRCm39) missense probably damaging 1.00
R2157:Adgra3 UTSW 5 50,159,283 (GRCm39) missense possibly damaging 0.87
R2281:Adgra3 UTSW 5 50,159,222 (GRCm39) missense probably benign 0.04
R2385:Adgra3 UTSW 5 50,136,908 (GRCm39) missense possibly damaging 0.95
R2426:Adgra3 UTSW 5 50,166,791 (GRCm39) missense possibly damaging 0.61
R3084:Adgra3 UTSW 5 50,170,733 (GRCm39) critical splice donor site probably null
R3086:Adgra3 UTSW 5 50,170,733 (GRCm39) critical splice donor site probably null
R3409:Adgra3 UTSW 5 50,159,272 (GRCm39) missense probably damaging 1.00
R3410:Adgra3 UTSW 5 50,159,272 (GRCm39) missense probably damaging 1.00
R3411:Adgra3 UTSW 5 50,159,272 (GRCm39) missense probably damaging 1.00
R4301:Adgra3 UTSW 5 50,118,420 (GRCm39) missense possibly damaging 0.94
R4475:Adgra3 UTSW 5 50,159,240 (GRCm39) missense probably damaging 1.00
R4569:Adgra3 UTSW 5 50,117,905 (GRCm39) missense probably damaging 1.00
R4607:Adgra3 UTSW 5 50,128,081 (GRCm39) missense probably damaging 0.98
R4667:Adgra3 UTSW 5 50,136,298 (GRCm39) missense possibly damaging 0.94
R4671:Adgra3 UTSW 5 50,136,710 (GRCm39) missense probably damaging 1.00
R4886:Adgra3 UTSW 5 50,156,537 (GRCm39) missense probably benign 0.07
R5197:Adgra3 UTSW 5 50,118,096 (GRCm39) missense probably benign 0.01
R5208:Adgra3 UTSW 5 50,168,857 (GRCm39) missense probably damaging 0.99
R5313:Adgra3 UTSW 5 50,118,651 (GRCm39) missense probably benign 0.24
R5435:Adgra3 UTSW 5 50,147,468 (GRCm39) missense probably damaging 0.99
R5663:Adgra3 UTSW 5 50,156,627 (GRCm39) missense probably benign 0.14
R6038:Adgra3 UTSW 5 50,156,487 (GRCm39) nonsense probably null
R6038:Adgra3 UTSW 5 50,156,487 (GRCm39) nonsense probably null
R6064:Adgra3 UTSW 5 50,117,667 (GRCm39) missense probably damaging 0.97
R6259:Adgra3 UTSW 5 50,156,483 (GRCm39) missense possibly damaging 0.63
R6272:Adgra3 UTSW 5 50,166,791 (GRCm39) missense possibly damaging 0.61
R6293:Adgra3 UTSW 5 50,118,189 (GRCm39) missense probably benign 0.21
R6296:Adgra3 UTSW 5 50,118,189 (GRCm39) missense probably benign 0.21
R6297:Adgra3 UTSW 5 50,118,189 (GRCm39) missense probably benign 0.21
R6352:Adgra3 UTSW 5 50,147,592 (GRCm39) missense probably benign 0.01
R6352:Adgra3 UTSW 5 50,136,478 (GRCm39) missense probably benign
R6989:Adgra3 UTSW 5 50,164,226 (GRCm39) missense probably damaging 1.00
R7026:Adgra3 UTSW 5 50,118,083 (GRCm39) missense probably benign
R7147:Adgra3 UTSW 5 50,118,587 (GRCm39) missense probably damaging 1.00
R7206:Adgra3 UTSW 5 50,164,238 (GRCm39) missense probably damaging 1.00
R7381:Adgra3 UTSW 5 50,216,116 (GRCm39) start codon destroyed probably null
R7508:Adgra3 UTSW 5 50,174,209 (GRCm39) missense probably benign 0.10
R7538:Adgra3 UTSW 5 50,118,792 (GRCm39) missense probably benign 0.01
R7579:Adgra3 UTSW 5 50,144,977 (GRCm39) missense probably benign
R7951:Adgra3 UTSW 5 50,121,126 (GRCm39) missense probably damaging 1.00
R8269:Adgra3 UTSW 5 50,121,079 (GRCm39) missense probably damaging 0.98
R8458:Adgra3 UTSW 5 50,145,013 (GRCm39) missense probably damaging 0.99
R8486:Adgra3 UTSW 5 50,147,621 (GRCm39) missense probably damaging 0.98
R8912:Adgra3 UTSW 5 50,118,273 (GRCm39) missense possibly damaging 0.61
R8955:Adgra3 UTSW 5 50,118,731 (GRCm39) missense probably benign 0.05
R9108:Adgra3 UTSW 5 50,136,295 (GRCm39) missense probably damaging 1.00
R9112:Adgra3 UTSW 5 50,118,395 (GRCm39) missense probably damaging 1.00
R9191:Adgra3 UTSW 5 50,145,006 (GRCm39) missense possibly damaging 0.88
R9267:Adgra3 UTSW 5 50,155,618 (GRCm39) missense possibly damaging 0.87
R9312:Adgra3 UTSW 5 50,117,900 (GRCm39) missense probably damaging 1.00
R9537:Adgra3 UTSW 5 50,118,207 (GRCm39) missense possibly damaging 0.82
R9614:Adgra3 UTSW 5 50,164,250 (GRCm39) missense probably damaging 1.00
RF005:Adgra3 UTSW 5 50,170,729 (GRCm39) splice site probably null
RF024:Adgra3 UTSW 5 50,170,729 (GRCm39) splice site probably null
RF036:Adgra3 UTSW 5 50,215,983 (GRCm39) small deletion probably benign
X0065:Adgra3 UTSW 5 50,129,304 (GRCm39) missense probably benign
Z1187:Adgra3 UTSW 5 50,136,421 (GRCm39) missense probably damaging 1.00
Z1192:Adgra3 UTSW 5 50,156,623 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACAGCGACACCATGATAGG -3'
(R):5'- CATCAGATTTATACAGAAGCCAGTCTC -3'

Sequencing Primer
(F):5'- GGTGGAGACGAGGCCCTTC -3'
(R):5'- GAAGCCAGTCTCATCCTTTAAAAC -3'
Posted On 2015-07-06