Incidental Mutation 'R4360:Csn1s2a'
ID 324849
Institutional Source Beutler Lab
Gene Symbol Csn1s2a
Ensembl Gene ENSMUSG00000061937
Gene Name casein alpha s2-like A
Synonyms Csn1s2a, Csng
MMRRC Submission 041111-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R4360 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 87922426-87936656 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 87929700 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 100 (V100L)
Ref Sequence ENSEMBL: ENSMUSP00000142901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076379] [ENSMUST00000196585] [ENSMUST00000196749] [ENSMUST00000200322]
AlphaFold Q02862
Predicted Effect possibly damaging
Transcript: ENSMUST00000076379
AA Change: V108L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075716
Gene: ENSMUSG00000061937
AA Change: V108L

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
coiled coil region 58 86 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196585
AA Change: V93L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143515
Gene: ENSMUSG00000061937
AA Change: V93L

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196749
AA Change: V107L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143715
Gene: ENSMUSG00000061937
AA Change: V107L

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
coiled coil region 57 85 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200200
Predicted Effect possibly damaging
Transcript: ENSMUST00000200322
AA Change: V100L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142901
Gene: ENSMUSG00000061937
AA Change: V100L

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200210
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 67,175,850 (GRCm39) noncoding transcript Het
Adgra3 T C 5: 50,147,552 (GRCm39) E496G possibly damaging Het
Atg14 C G 14: 47,805,827 (GRCm39) E13Q probably benign Het
BC023105 G T 18: 60,575,073 (GRCm39) noncoding transcript Het
Chd6 A G 2: 160,791,776 (GRCm39) V2527A possibly damaging Het
Fah G A 7: 84,238,856 (GRCm39) L330F probably damaging Het
Fmo2 T C 1: 162,709,583 (GRCm39) N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,431,475 (GRCm39) probably benign Het
Frmd4a A T 2: 4,606,052 (GRCm39) H287L probably damaging Het
G2e3 T A 12: 51,410,197 (GRCm39) probably benign Het
Gm1758 A T 16: 14,324,215 (GRCm39) noncoding transcript Het
Gm7204 T C 16: 48,039,196 (GRCm39) noncoding transcript Het
Gm829 T C 4: 45,718,819 (GRCm39) noncoding transcript Het
Hspa14 A G 2: 3,503,560 (GRCm39) V116A possibly damaging Het
Hspa4 T C 11: 53,155,919 (GRCm39) Y662C probably damaging Het
Islr T A 9: 58,064,887 (GRCm39) N207Y probably damaging Het
Lipc T C 9: 70,759,864 (GRCm39) probably benign Het
Ncor2 A G 5: 125,106,036 (GRCm39) S1546P probably damaging Het
Or13a25 T C 7: 140,247,730 (GRCm39) F170L probably damaging Het
Or56a3 A C 7: 104,735,460 (GRCm39) E179A probably damaging Het
Or7g18 G A 9: 18,787,013 (GRCm39) C127Y probably damaging Het
Parp4 A G 14: 56,866,661 (GRCm39) D1075G possibly damaging Het
Pkp2 A G 16: 16,086,546 (GRCm39) I736V probably benign Het
Plekha8 T C 6: 54,599,171 (GRCm39) I235T probably benign Het
Polq A G 16: 36,880,701 (GRCm39) D955G probably benign Het
Pramel16 A G 4: 143,677,433 (GRCm39) F49L possibly damaging Het
Psmd1 A G 1: 86,061,459 (GRCm39) K890E probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scpep1 A G 11: 88,821,070 (GRCm39) Y366H possibly damaging Het
Slc18a3 A G 14: 32,185,882 (GRCm39) V167A probably benign Het
Sp8 A G 12: 118,812,400 (GRCm39) D85G possibly damaging Het
Stard3nl G A 13: 19,554,654 (GRCm39) S144L probably damaging Het
Stk4 A G 2: 163,930,879 (GRCm39) E160G possibly damaging Het
Tbcb T C 7: 29,926,460 (GRCm39) N119S probably benign Het
Tnc G T 4: 63,935,161 (GRCm39) R592S probably benign Het
Trem3 T A 17: 48,556,801 (GRCm39) S91T probably benign Het
Trpc6 A G 9: 8,610,267 (GRCm39) E245G probably benign Het
Usp40 C T 1: 87,880,083 (GRCm39) R1036H probably damaging Het
Usp47 G T 7: 111,654,139 (GRCm39) G112C probably damaging Het
Wdr35 T C 12: 9,024,149 (GRCm39) probably benign Het
Zc3h14 A G 12: 98,746,456 (GRCm39) K555R probably benign Het
Zfp26 T C 9: 20,349,869 (GRCm39) S232G probably benign Het
Zfp811 T C 17: 33,017,432 (GRCm39) T202A probably benign Het
Other mutations in Csn1s2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Csn1s2a APN 5 87,932,439 (GRCm39) missense possibly damaging 0.83
IGL01829:Csn1s2a APN 5 87,934,569 (GRCm39) missense unknown
R0137:Csn1s2a UTSW 5 87,926,826 (GRCm39) missense possibly damaging 0.46
R1503:Csn1s2a UTSW 5 87,923,658 (GRCm39) missense possibly damaging 0.66
R1799:Csn1s2a UTSW 5 87,926,052 (GRCm39) missense probably damaging 0.97
R1870:Csn1s2a UTSW 5 87,926,058 (GRCm39) missense probably benign 0.27
R2400:Csn1s2a UTSW 5 87,928,014 (GRCm39) critical splice donor site probably null
R2897:Csn1s2a UTSW 5 87,929,680 (GRCm39) missense unknown
R4034:Csn1s2a UTSW 5 87,929,746 (GRCm39) missense probably benign 0.27
R4377:Csn1s2a UTSW 5 87,923,680 (GRCm39) missense probably benign
R4834:Csn1s2a UTSW 5 87,929,637 (GRCm39) missense probably benign 0.27
R4965:Csn1s2a UTSW 5 87,929,697 (GRCm39) missense possibly damaging 0.83
R6807:Csn1s2a UTSW 5 87,929,731 (GRCm39) missense probably benign
R7115:Csn1s2a UTSW 5 87,929,664 (GRCm39) missense probably benign 0.00
R7353:Csn1s2a UTSW 5 87,933,161 (GRCm39) missense possibly damaging 0.66
R7420:Csn1s2a UTSW 5 87,927,865 (GRCm39) missense possibly damaging 0.83
R8932:Csn1s2a UTSW 5 87,933,164 (GRCm39) missense probably benign 0.05
R9074:Csn1s2a UTSW 5 87,934,458 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTTTGTCAAACTGGCATAG -3'
(R):5'- ATCACACATGAATGGTTTTGCG -3'

Sequencing Primer
(F):5'- GACCTATGAAGAATAGTCACTAC -3'
(R):5'- CACATGAATGGTTTTGCGTGATTTAC -3'
Posted On 2015-07-06