Incidental Mutation 'R4360:Olfr539'
ID 324856
Institutional Source Beutler Lab
Gene Symbol Olfr539
Ensembl Gene ENSMUSG00000059136
Gene Name olfactory receptor 539
Synonyms MOR253-4, GA_x6K02T2PBJ9-42813436-42814368
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4360 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140659930-140678580 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140667817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 170 (F170L)
Ref Sequence ENSEMBL: ENSMUSP00000151522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000210973] [ENSMUST00000218865]
AlphaFold Q8VGL9
Predicted Effect possibly damaging
Transcript: ENSMUST00000078967
AA Change: F177L

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: F177L

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210973
AA Change: F170L
Predicted Effect probably damaging
Transcript: ENSMUST00000218865
AA Change: F170L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219853
Meta Mutation Damage Score 0.2393 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Olfr539
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr539 APN 7 140667941 missense probably benign 0.01
IGL01610:Olfr539 APN 7 140667671 missense probably damaging 1.00
IGL02959:Olfr539 APN 7 140667550 missense probably damaging 1.00
IGL03406:Olfr539 APN 7 140667511 missense probably damaging 1.00
R0671:Olfr539 UTSW 7 140667677 missense probably damaging 1.00
R1771:Olfr539 UTSW 7 140668135 missense probably benign
R1934:Olfr539 UTSW 7 140668038 nonsense probably null
R1985:Olfr539 UTSW 7 140667821 missense probably damaging 1.00
R2962:Olfr539 UTSW 7 140667949 missense probably benign
R4239:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4240:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4841:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4842:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4851:Olfr539 UTSW 7 140667313 missense probably benign
R5325:Olfr539 UTSW 7 140667792 missense probably benign 0.33
R5766:Olfr539 UTSW 7 140667353 missense probably benign 0.02
R6363:Olfr539 UTSW 7 140668082 missense possibly damaging 0.93
R6836:Olfr539 UTSW 7 140668180 missense possibly damaging 0.86
R7777:Olfr539 UTSW 7 140667941 missense probably benign 0.01
R7920:Olfr539 UTSW 7 140667901 missense possibly damaging 0.92
R8134:Olfr539 UTSW 7 140667767 missense possibly damaging 0.90
R8712:Olfr539 UTSW 7 140668139 missense possibly damaging 0.89
R9095:Olfr539 UTSW 7 140667900 missense probably damaging 1.00
R9158:Olfr539 UTSW 7 140667634 missense possibly damaging 0.76
R9603:Olfr539 UTSW 7 140667881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTTCAAGGGATGTATGTCC -3'
(R):5'- GCAGGATGCTGGCAATGATG -3'

Sequencing Primer
(F):5'- ACATGGTCAGCATCCTCTGAG -3'
(R):5'- TGCAGCCATAAGACAACAAGGTTAG -3'
Posted On 2015-07-06