Incidental Mutation 'R4360:Or7g18'
ID 324858
Institutional Source Beutler Lab
Gene Symbol Or7g18
Ensembl Gene ENSMUSG00000062868
Gene Name olfactory receptor family 7 subfamily G member 18
Synonyms GA_x6K02T2PVTD-12618399-12619337, Olfr830, MOR152-1
MMRRC Submission 041111-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R4360 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 18786256-18787572 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 18787013 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 127 (C127Y)
Ref Sequence ENSEMBL: ENSMUSP00000148394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078861] [ENSMUST00000212723]
AlphaFold Q8VFJ5
Predicted Effect probably damaging
Transcript: ENSMUST00000078861
AA Change: C130Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077903
Gene: ENSMUSG00000062868
AA Change: C130Y

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7tm_1 44 293 1.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212723
AA Change: C127Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 67,175,850 (GRCm39) noncoding transcript Het
Adgra3 T C 5: 50,147,552 (GRCm39) E496G possibly damaging Het
Atg14 C G 14: 47,805,827 (GRCm39) E13Q probably benign Het
BC023105 G T 18: 60,575,073 (GRCm39) noncoding transcript Het
Chd6 A G 2: 160,791,776 (GRCm39) V2527A possibly damaging Het
Csn1s2a G T 5: 87,929,700 (GRCm39) V100L possibly damaging Het
Fah G A 7: 84,238,856 (GRCm39) L330F probably damaging Het
Fmo2 T C 1: 162,709,583 (GRCm39) N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,431,475 (GRCm39) probably benign Het
Frmd4a A T 2: 4,606,052 (GRCm39) H287L probably damaging Het
G2e3 T A 12: 51,410,197 (GRCm39) probably benign Het
Gm1758 A T 16: 14,324,215 (GRCm39) noncoding transcript Het
Gm7204 T C 16: 48,039,196 (GRCm39) noncoding transcript Het
Gm829 T C 4: 45,718,819 (GRCm39) noncoding transcript Het
Hspa14 A G 2: 3,503,560 (GRCm39) V116A possibly damaging Het
Hspa4 T C 11: 53,155,919 (GRCm39) Y662C probably damaging Het
Islr T A 9: 58,064,887 (GRCm39) N207Y probably damaging Het
Lipc T C 9: 70,759,864 (GRCm39) probably benign Het
Ncor2 A G 5: 125,106,036 (GRCm39) S1546P probably damaging Het
Or13a25 T C 7: 140,247,730 (GRCm39) F170L probably damaging Het
Or56a3 A C 7: 104,735,460 (GRCm39) E179A probably damaging Het
Parp4 A G 14: 56,866,661 (GRCm39) D1075G possibly damaging Het
Pkp2 A G 16: 16,086,546 (GRCm39) I736V probably benign Het
Plekha8 T C 6: 54,599,171 (GRCm39) I235T probably benign Het
Polq A G 16: 36,880,701 (GRCm39) D955G probably benign Het
Pramel16 A G 4: 143,677,433 (GRCm39) F49L possibly damaging Het
Psmd1 A G 1: 86,061,459 (GRCm39) K890E probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scpep1 A G 11: 88,821,070 (GRCm39) Y366H possibly damaging Het
Slc18a3 A G 14: 32,185,882 (GRCm39) V167A probably benign Het
Sp8 A G 12: 118,812,400 (GRCm39) D85G possibly damaging Het
Stard3nl G A 13: 19,554,654 (GRCm39) S144L probably damaging Het
Stk4 A G 2: 163,930,879 (GRCm39) E160G possibly damaging Het
Tbcb T C 7: 29,926,460 (GRCm39) N119S probably benign Het
Tnc G T 4: 63,935,161 (GRCm39) R592S probably benign Het
Trem3 T A 17: 48,556,801 (GRCm39) S91T probably benign Het
Trpc6 A G 9: 8,610,267 (GRCm39) E245G probably benign Het
Usp40 C T 1: 87,880,083 (GRCm39) R1036H probably damaging Het
Usp47 G T 7: 111,654,139 (GRCm39) G112C probably damaging Het
Wdr35 T C 12: 9,024,149 (GRCm39) probably benign Het
Zc3h14 A G 12: 98,746,456 (GRCm39) K555R probably benign Het
Zfp26 T C 9: 20,349,869 (GRCm39) S232G probably benign Het
Zfp811 T C 17: 33,017,432 (GRCm39) T202A probably benign Het
Other mutations in Or7g18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Or7g18 APN 9 18,787,310 (GRCm39) nonsense probably null
IGL00954:Or7g18 APN 9 18,787,369 (GRCm39) missense probably benign 0.15
IGL01090:Or7g18 APN 9 18,787,538 (GRCm39) missense probably benign 0.00
IGL01613:Or7g18 APN 9 18,786,617 (GRCm39) splice site probably benign
IGL01987:Or7g18 APN 9 18,787,003 (GRCm39) missense probably benign 0.00
IGL03018:Or7g18 APN 9 18,787,523 (GRCm39) missense probably benign 0.15
IGL03037:Or7g18 APN 9 18,786,668 (GRCm39) missense probably damaging 0.98
R0284:Or7g18 UTSW 9 18,786,848 (GRCm39) missense probably benign
R1322:Or7g18 UTSW 9 18,786,817 (GRCm39) missense possibly damaging 0.90
R1715:Or7g18 UTSW 9 18,787,090 (GRCm39) missense probably benign 0.06
R1803:Or7g18 UTSW 9 18,787,376 (GRCm39) missense probably damaging 1.00
R4394:Or7g18 UTSW 9 18,786,907 (GRCm39) missense probably damaging 0.98
R4642:Or7g18 UTSW 9 18,787,463 (GRCm39) missense probably damaging 1.00
R4796:Or7g18 UTSW 9 18,787,475 (GRCm39) missense probably damaging 0.96
R4814:Or7g18 UTSW 9 18,787,213 (GRCm39) missense probably benign 0.30
R5210:Or7g18 UTSW 9 18,787,103 (GRCm39) missense probably damaging 1.00
R5375:Or7g18 UTSW 9 18,787,442 (GRCm39) missense probably benign 0.08
R6072:Or7g18 UTSW 9 18,786,718 (GRCm39) missense probably benign
R6361:Or7g18 UTSW 9 18,787,027 (GRCm39) missense probably damaging 1.00
R6602:Or7g18 UTSW 9 18,787,145 (GRCm39) missense possibly damaging 0.81
R6920:Or7g18 UTSW 9 18,786,821 (GRCm39) missense probably damaging 1.00
R7730:Or7g18 UTSW 9 18,786,709 (GRCm39) missense probably benign 0.00
R7780:Or7g18 UTSW 9 18,786,910 (GRCm39) missense possibly damaging 0.65
R8245:Or7g18 UTSW 9 18,787,126 (GRCm39) missense probably benign
R8274:Or7g18 UTSW 9 18,786,795 (GRCm39) missense probably benign 0.36
R8920:Or7g18 UTSW 9 18,787,394 (GRCm39) missense probably damaging 1.00
R9564:Or7g18 UTSW 9 18,786,640 (GRCm39) missense probably benign 0.00
X0026:Or7g18 UTSW 9 18,786,931 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCATCAAGTGTGACTTCC -3'
(R):5'- GGCAAGCTTCAGGATTTGTG -3'

Sequencing Primer
(F):5'- ATCAAGTGTGACTTCCATCTTCAC -3'
(R):5'- GCTTCAGGATTTGTGCAATTTCACAG -3'
Posted On 2015-07-06