Incidental Mutation 'R0010:Olfr835'
ID32486
Institutional Source Beutler Lab
Gene Symbol Olfr835
Ensembl Gene ENSMUSG00000045204
Gene Nameolfactory receptor 835
SynonymsMOR150-3, GA_x6K02T2PVTD-12771995-12772930
MMRRC Submission 038305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R0010 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location19032735-19037670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19035322 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 66 (L66F)
Ref Sequence ENSEMBL: ENSMUSP00000148416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059315] [ENSMUST00000213018]
Predicted Effect probably damaging
Transcript: ENSMUST00000059315
AA Change: L66F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052610
Gene: ENSMUSG00000045204
AA Change: L66F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 206 2.9e-7 PFAM
Pfam:7tm_1 41 303 1.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213018
AA Change: L66F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,205,609 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Bbs7 T C 3: 36,607,717 probably null Het
BC037034 T C 5: 138,260,293 probably null Het
Cacna1h T C 17: 25,380,844 K1566E probably damaging Het
Ccdc73 C T 2: 104,980,987 probably benign Het
Cd74 A T 18: 60,809,071 H124L probably benign Het
Cd74 A T 18: 60,803,896 probably benign Het
Cdk5rap2 T C 4: 70,243,459 E270G probably benign Het
Ces2a G A 8: 104,741,396 D520N probably benign Het
Cldnd1 T A 16: 58,731,259 probably benign Het
Cox17 T A 16: 38,347,170 C24S possibly damaging Het
Cyp2b9 T A 7: 26,186,753 probably benign Het
Dennd4a T C 9: 64,896,715 L1112P probably benign Het
Dennd4c T C 4: 86,781,577 S222P probably damaging Het
Dhx37 T A 5: 125,431,616 Q85L probably benign Het
Egfem1 G T 3: 29,582,919 C192F probably damaging Het
Eif3f A T 7: 108,941,005 N336Y possibly damaging Het
Evc2 T A 5: 37,417,449 L1016Q probably damaging Het
Fam114a2 G T 11: 57,514,156 T40N probably damaging Het
Fam135b T C 15: 71,622,032 K16R probably damaging Het
Fcho1 A G 8: 71,709,999 Y725H probably damaging Het
Frem1 T C 4: 83,000,098 I536V probably benign Het
Ginm1 T C 10: 7,775,374 probably benign Het
Glrb A T 3: 80,860,315 probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10320 T C 13: 98,489,546 Y110C probably damaging Het
Gm20388 G A 8: 122,270,598 probably benign Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm5422 A G 10: 31,249,754 noncoding transcript Het
Igkv6-29 A T 6: 70,138,770 probably benign Het
Inpp5d G A 1: 87,697,546 probably null Het
Itpr3 T G 17: 27,120,977 V2610G probably damaging Het
Kmt5c T A 7: 4,746,208 M88K probably benign Het
Lrp12 C T 15: 39,878,276 A367T probably damaging Het
Ltbp1 A G 17: 75,363,391 T1476A probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Milr1 T G 11: 106,767,003 *209G probably null Het
Mitf A G 6: 97,807,281 K33R probably benign Het
Mon2 A C 10: 123,032,694 S485A probably damaging Het
Mpdu1 C T 11: 69,658,841 G47R probably damaging Het
Ms4a4d A G 19: 11,554,826 N112S probably damaging Het
Mybpc3 G A 2: 91,134,833 W1082* probably null Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Naa15 A T 3: 51,436,213 probably null Het
Nav3 A G 10: 109,823,226 probably benign Het
Nek7 T A 1: 138,544,204 Q66L possibly damaging Het
Nktr G A 9: 121,741,166 probably benign Het
Nlgn1 G T 3: 25,435,842 probably benign Het
Npr1 T C 3: 90,454,832 E1002G probably damaging Het
Nup133 A T 8: 123,904,579 I1072N probably damaging Het
Oc90 C T 15: 65,876,548 C371Y probably damaging Het
Olfr901 A T 9: 38,430,920 I213F possibly damaging Het
Olfr994 A T 2: 85,429,895 D311E probably benign Het
Pradc1 A T 6: 85,447,231 N44K probably damaging Het
Pradc1 T C 6: 85,447,620 D116G probably damaging Het
Ptprk G A 10: 28,585,969 C91Y probably damaging Het
Pus7 T C 5: 23,747,845 I491V probably benign Het
Rock1 T A 18: 10,084,380 D951V probably damaging Het
Scgb2b26 T A 7: 33,944,349 E55D probably damaging Het
Scn8a T C 15: 101,013,573 V958A probably damaging Het
Sec14l1 T C 11: 117,143,770 probably benign Het
Sec24c A G 14: 20,689,261 probably benign Het
Sema6b C T 17: 56,124,105 E853K probably benign Het
Sgk1 G A 10: 21,997,438 probably null Het
Shprh C T 10: 11,151,931 T94I probably benign Het
Slc16a3 T C 11: 120,956,705 S240P probably benign Het
Slc5a8 T C 10: 88,886,590 V95A probably benign Het
Smg1 A T 7: 118,171,859 probably benign Het
Spta1 G A 1: 174,217,943 V1556I probably benign Het
Svs1 A T 6: 48,988,906 H616L probably damaging Het
Trappc4 G A 9: 44,405,231 probably benign Het
Tubgcp6 A G 15: 89,103,183 S1188P probably benign Het
Txlna T G 4: 129,629,086 D487A probably benign Het
Ube2d2b T C 5: 107,830,636 F51S possibly damaging Het
Vmn2r6 G A 3: 64,559,545 Q178* probably null Het
Wdfy3 T C 5: 101,848,349 T3234A probably damaging Het
Ylpm1 C A 12: 85,029,026 Q384K probably damaging Het
Zbtb41 T G 1: 139,423,530 V127G probably damaging Het
Zfp605 T A 5: 110,127,534 C173S probably benign Het
Zfp608 A T 18: 54,895,214 probably benign Het
Zhx2 T C 15: 57,821,274 V13A possibly damaging Het
Other mutations in Olfr835
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Olfr835 APN 9 19035288 nonsense probably null
IGL02546:Olfr835 APN 9 19035354 missense possibly damaging 0.88
R0107:Olfr835 UTSW 9 19035333 missense probably damaging 1.00
R1867:Olfr835 UTSW 9 19035266 missense probably benign 0.36
R1891:Olfr835 UTSW 9 19035978 missense probably damaging 0.99
R1941:Olfr835 UTSW 9 19035866 missense possibly damaging 0.93
R4152:Olfr835 UTSW 9 19035520 nonsense probably null
R5451:Olfr835 UTSW 9 19035491 missense probably damaging 1.00
R5677:Olfr835 UTSW 9 19035558 missense possibly damaging 0.93
R5970:Olfr835 UTSW 9 19035147 missense probably benign
R6187:Olfr835 UTSW 9 19035393 missense probably benign 0.12
R6805:Olfr835 UTSW 9 19035301 missense probably damaging 1.00
R7183:Olfr835 UTSW 9 19035332 missense probably damaging 1.00
R8029:Olfr835 UTSW 9 19035794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACAGATGATCCAACTGTGAAGCCTG -3'
(R):5'- CCATGAGACCAAGAAGTCCCATGTTC -3'

Sequencing Primer
(F):5'- AACTGTGAAGCCTGTGATCTTTTG -3'
(R):5'- GTCCCATGTTCAAAACGCTAATG -3'
Posted On2013-05-09