Incidental Mutation 'R4360:Islr'
ID324860
Institutional Source Beutler Lab
Gene Symbol Islr
Ensembl Gene ENSMUSG00000037206
Gene Nameimmunoglobulin superfamily containing leucine-rich repeat
Synonyms
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R4360 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58156268-58204306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58157604 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 207 (N207Y)
Ref Sequence ENSEMBL: ENSMUSP00000126963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000041477] [ENSMUST00000085677] [ENSMUST00000167479] [ENSMUST00000168864] [ENSMUST00000170397] [ENSMUST00000217578]
Predicted Effect probably benign
Transcript: ENSMUST00000034880
SMART Domains Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041477
AA Change: N207Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045142
Gene: ENSMUSG00000037206
AA Change: N207Y

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LRRNT 18 54 3.32e-1 SMART
LRR 50 72 1.49e1 SMART
LRR 73 96 5.26e0 SMART
LRR 97 120 1.86e1 SMART
LRR_TYP 121 144 5.81e-2 SMART
LRR_TYP 145 168 5.21e-4 SMART
LRRCT 180 230 2.42e-9 SMART
IGc2 248 334 9.78e-7 SMART
low complexity region 408 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085677
SMART Domains Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 41 658 1.9e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167479
SMART Domains Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168864
AA Change: N207Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126963
Gene: ENSMUSG00000037206
AA Change: N207Y

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LRRNT 18 54 3.32e-1 SMART
LRR 50 72 1.49e1 SMART
LRR 73 96 5.26e0 SMART
LRR 97 120 1.86e1 SMART
LRR_TYP 121 144 5.81e-2 SMART
LRR_TYP 145 168 5.21e-4 SMART
LRRCT 180 230 2.42e-9 SMART
IGc2 248 334 9.78e-7 SMART
low complexity region 408 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170397
SMART Domains Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217578
Meta Mutation Damage Score 0.1429 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: The gene product suppresses differentiation of bone marrow stromal and skeletal stem cells into skeletal lineages. Homozygous knockout leads to growth retardation and longer long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Islr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Islr APN 9 58157228 missense probably damaging 1.00
IGL02169:Islr APN 9 58158132 missense possibly damaging 0.92
IGL02369:Islr APN 9 58157624 missense probably damaging 1.00
IGL02930:Islr APN 9 58158200 unclassified probably benign
PIT4581001:Islr UTSW 9 58157201 missense possibly damaging 0.92
R1121:Islr UTSW 9 58157762 missense probably benign 0.21
R1470:Islr UTSW 9 58157306 missense probably damaging 1.00
R1470:Islr UTSW 9 58157306 missense probably damaging 1.00
R1638:Islr UTSW 9 58158219 unclassified probably benign
R1699:Islr UTSW 9 58157495 missense probably damaging 1.00
R4677:Islr UTSW 9 58157359 missense probably damaging 1.00
R4707:Islr UTSW 9 58157687 missense possibly damaging 0.75
R4856:Islr UTSW 9 58157606 missense probably damaging 0.99
R5354:Islr UTSW 9 58157612 missense probably damaging 1.00
R6343:Islr UTSW 9 58157096 missense probably damaging 1.00
R6768:Islr UTSW 9 58157610 missense possibly damaging 0.75
R7050:Islr UTSW 9 58157717 missense probably damaging 1.00
R7216:Islr UTSW 9 58156967 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCCATCCACGTCACAGTG -3'
(R):5'- TGCTCAAGATGGACAGCAACG -3'

Sequencing Primer
(F):5'- ACGTCACAGTGGAGTGCC -3'
(R):5'- TGGACAGCAACGAGTTAGCCTTC -3'
Posted On2015-07-06