Incidental Mutation 'R4360:Hspa4'
Institutional Source Beutler Lab
Gene Symbol Hspa4
Ensembl Gene ENSMUSG00000020361
Gene Nameheat shock protein 4
Synonyms70kDa, Hsp70RY, Hsp110, APG-2
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R4360 (G1)
Quality Score225
Status Validated
Chromosomal Location53259814-53300457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53265092 bp
Amino Acid Change Tyrosine to Cysteine at position 662 (Y662C)
Ref Sequence ENSEMBL: ENSMUSP00000020630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020630]
Predicted Effect probably damaging
Transcript: ENSMUST00000020630
AA Change: Y662C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020630
Gene: ENSMUSG00000020361
AA Change: Y662C

Pfam:HSP70 3 608 2.9e-211 PFAM
Pfam:HSP70 590 693 3.8e-10 PFAM
low complexity region 787 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151854
Meta Mutation Damage Score 0.5797 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit age-dependent neurofibrillary tangles and tau deposits, impaired contextual conditioning, and impaired bar grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Hspa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Hspa4 APN 11 53280717 splice site probably null
IGL00701:Hspa4 APN 11 53271033 missense possibly damaging 0.89
IGL00957:Hspa4 APN 11 53280687 missense probably benign 0.00
IGL02324:Hspa4 APN 11 53300058 critical splice donor site probably null
IGL02328:Hspa4 APN 11 53300058 critical splice donor site probably null
IGL02336:Hspa4 APN 11 53262373 missense probably benign 0.00
IGL02441:Hspa4 APN 11 53270982 missense probably benign 0.03
IGL03323:Hspa4 APN 11 53265133 missense probably benign 0.05
IGL03356:Hspa4 APN 11 53269800 missense probably damaging 1.00
R0027:Hspa4 UTSW 11 53283585 missense probably benign 0.00
R0398:Hspa4 UTSW 11 53272879 critical splice acceptor site probably null
R0568:Hspa4 UTSW 11 53262876 splice site probably benign
R0655:Hspa4 UTSW 11 53269692 missense probably benign 0.02
R1876:Hspa4 UTSW 11 53284156 missense probably benign 0.16
R2225:Hspa4 UTSW 11 53286933 missense probably benign 0.28
R3813:Hspa4 UTSW 11 53270979 missense probably benign 0.21
R3937:Hspa4 UTSW 11 53270949 missense probably benign 0.13
R4457:Hspa4 UTSW 11 53280568 missense probably damaging 1.00
R4492:Hspa4 UTSW 11 53280469 missense probably damaging 1.00
R4751:Hspa4 UTSW 11 53284199 missense probably benign 0.22
R5032:Hspa4 UTSW 11 53289123 missense possibly damaging 0.89
R5233:Hspa4 UTSW 11 53286975 missense possibly damaging 0.46
R5320:Hspa4 UTSW 11 53262983 missense probably damaging 1.00
R5650:Hspa4 UTSW 11 53265092 missense probably damaging 1.00
R6108:Hspa4 UTSW 11 53261712 missense probably damaging 0.97
R6211:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6232:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6234:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6235:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6243:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6245:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6468:Hspa4 UTSW 11 53265056 missense probably benign 0.03
R7194:Hspa4 UTSW 11 53265938 missense probably damaging 1.00
R7308:Hspa4 UTSW 11 53267103 missense possibly damaging 0.70
R7654:Hspa4 UTSW 11 53300124 missense probably damaging 0.98
R7731:Hspa4 UTSW 11 53266964 critical splice donor site probably null
R7813:Hspa4 UTSW 11 53272036 missense probably damaging 1.00
R7841:Hspa4 UTSW 11 53267060 missense possibly damaging 0.95
R7849:Hspa4 UTSW 11 53280703 missense possibly damaging 0.88
R7913:Hspa4 UTSW 11 53262307 missense probably benign 0.01
R7924:Hspa4 UTSW 11 53267060 missense possibly damaging 0.95
R7932:Hspa4 UTSW 11 53280703 missense possibly damaging 0.88
R7994:Hspa4 UTSW 11 53262307 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-06