Incidental Mutation 'R4360:Scpep1'
ID324863
Institutional Source Beutler Lab
Gene Symbol Scpep1
Ensembl Gene ENSMUSG00000000278
Gene Nameserine carboxypeptidase 1
Synonyms4833411K15Rik, 2410018F01Rik, Risc
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4360 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location88924020-88955465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88930244 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 366 (Y366H)
Ref Sequence ENSEMBL: ENSMUSP00000000287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000287]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000287
AA Change: Y366H

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000287
Gene: ENSMUSG00000000278
AA Change: Y366H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_S10 29 451 2e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139592
Meta Mutation Damage Score 0.8987 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit no abnormal phenotype. Mice homozygous for a knock-out allele exhibit abnormal blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Scpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Scpep1 APN 11 88952477 missense probably damaging 1.00
IGL01123:Scpep1 APN 11 88941328 missense possibly damaging 0.79
IGL02341:Scpep1 APN 11 88944488 missense probably benign 0.30
IGL03078:Scpep1 APN 11 88935831 missense possibly damaging 0.67
IGL03014:Scpep1 UTSW 11 88933445 splice site probably null
R1652:Scpep1 UTSW 11 88952434 nonsense probably null
R1966:Scpep1 UTSW 11 88952414 missense probably damaging 1.00
R4275:Scpep1 UTSW 11 88947142 splice site probably null
R4330:Scpep1 UTSW 11 88935903 nonsense probably null
R4331:Scpep1 UTSW 11 88935903 nonsense probably null
R4502:Scpep1 UTSW 11 88944385 missense probably benign 0.00
R4885:Scpep1 UTSW 11 88935911 missense probably benign 0.20
R4896:Scpep1 UTSW 11 88941296 missense probably damaging 1.00
R5010:Scpep1 UTSW 11 88941349 missense probably benign 0.30
R5229:Scpep1 UTSW 11 88937045 missense probably damaging 1.00
R5899:Scpep1 UTSW 11 88934576 critical splice donor site probably null
R5999:Scpep1 UTSW 11 88929313 missense possibly damaging 0.85
R6975:Scpep1 UTSW 11 88947205 missense probably damaging 0.98
R7098:Scpep1 UTSW 11 88929185 missense possibly damaging 0.59
R7637:Scpep1 UTSW 11 88929220 missense probably damaging 1.00
R7790:Scpep1 UTSW 11 88933521 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AGACCCAGAGTTCTCTCATGC -3'
(R):5'- AACCATAGTTTAGAATGCTTGGGC -3'

Sequencing Primer
(F):5'- AGAGTTCTCTCATGCATCACAG -3'
(R):5'- TGCTTGGGCAGAAAGAGATTTC -3'
Posted On2015-07-06