Incidental Mutation 'R4360:Foxg1'
ID324865
Institutional Source Beutler Lab
Gene Symbol Foxg1
Ensembl Gene ENSMUSG00000020950
Gene Nameforkhead box G1
SynonymsHfh9, BF-1, 2900064B05Rik, Hfhbf1, Bf1
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4360 (G1)
Quality Score135
Status Validated
Chromosome12
Chromosomal Location49382660-49386861 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC at 49384692 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021333] [ENSMUST00000179669]
Predicted Effect probably benign
Transcript: ENSMUST00000021333
SMART Domains Protein: ENSMUSP00000021333
Gene: ENSMUSG00000020950

DomainStartEndE-ValueType
low complexity region 32 91 N/A INTRINSIC
low complexity region 107 134 N/A INTRINSIC
FH 171 261 6.85e-63 SMART
low complexity region 367 378 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110746
SMART Domains Protein: ENSMUSP00000106374
Gene: ENSMUSG00000089922

DomainStartEndE-ValueType
low complexity region 120 131 N/A INTRINSIC
low complexity region 169 198 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154930
Predicted Effect probably benign
Transcript: ENSMUST00000179669
SMART Domains Protein: ENSMUSP00000136372
Gene: ENSMUSG00000020950

DomainStartEndE-ValueType
low complexity region 32 91 N/A INTRINSIC
low complexity region 107 134 N/A INTRINSIC
FH 171 261 6.85e-63 SMART
low complexity region 367 378 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218927
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the forked-head transcription factor family. The encoded protein, which functions as a repressor, may play a role in brain development. Mutations at this locus have been associated with Rett syndrome. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutants exhibit dramatically reduced cerebral hemispheres, missing ventral telencephalic structures, impaired migration of efferent thalamocortical axons, and multiple eye defects. Mutants die at birth from respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Foxg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Foxg1 APN 12 49385620 missense possibly damaging 0.94
IGL02629:Foxg1 APN 12 49385548 missense probably benign 0.02
R0267:Foxg1 UTSW 12 49385582 missense probably damaging 1.00
R0486:Foxg1 UTSW 12 49384531 unclassified probably benign
R0646:Foxg1 UTSW 12 49384567 unclassified probably benign
R2110:Foxg1 UTSW 12 49384925 unclassified probably benign
R3784:Foxg1 UTSW 12 49385599 missense probably benign 0.04
R4198:Foxg1 UTSW 12 49385299 missense possibly damaging 0.81
R4199:Foxg1 UTSW 12 49385299 missense possibly damaging 0.81
R4200:Foxg1 UTSW 12 49385299 missense possibly damaging 0.81
R5044:Foxg1 UTSW 12 49385186 missense probably damaging 1.00
R6053:Foxg1 UTSW 12 49385378 missense possibly damaging 0.62
R6277:Foxg1 UTSW 12 49385516 missense probably benign 0.06
R6485:Foxg1 UTSW 12 49385080 missense probably damaging 1.00
R6979:Foxg1 UTSW 12 49384784 unclassified probably benign
R7033:Foxg1 UTSW 12 49384720 unclassified probably benign
R8156:Foxg1 UTSW 12 49384646 missense unknown
R8193:Foxg1 UTSW 12 49385594 missense possibly damaging 0.83
R8511:Foxg1 UTSW 12 49385085 nonsense probably null
R8789:Foxg1 UTSW 12 49385360 missense probably benign 0.43
R8909:Foxg1 UTSW 12 49384692 small deletion probably benign
R8958:Foxg1 UTSW 12 49385161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTCCCAAGTCCTCGTTCAGC -3'
(R):5'- TGAGCGCGTTGTAGCTGAAC -3'

Sequencing Primer
(F):5'- GTTCAGCATCAACAGCCTGGTC -3'
(R):5'- TGAACGGCGGCTTCTCGTAC -3'
Posted On2015-07-06