Incidental Mutation 'R4360:Stard3nl'
Institutional Source Beutler Lab
Gene Symbol Stard3nl
Ensembl Gene ENSMUSG00000003062
Gene NameSTARD3 N-terminal like
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4360 (G1)
Quality Score225
Status Validated
Chromosomal Location19357676-19395795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19370484 bp
Amino Acid Change Serine to Leucine at position 144 (S144L)
Ref Sequence ENSEMBL: ENSMUSP00000152373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039694] [ENSMUST00000197565] [ENSMUST00000200323] [ENSMUST00000221380] [ENSMUST00000222869]
Predicted Effect probably damaging
Transcript: ENSMUST00000039694
AA Change: S144L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037991
Gene: ENSMUSG00000003062
AA Change: S144L

Pfam:MENTAL 49 214 2.6e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196712
Predicted Effect probably damaging
Transcript: ENSMUST00000197565
AA Change: S144L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199278
Predicted Effect probably damaging
Transcript: ENSMUST00000200323
AA Change: S144L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142680
Gene: ENSMUSG00000003062
AA Change: S144L

Pfam:MENTAL 49 216 2e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221380
AA Change: S144L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222869
AA Change: S144L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2524 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a late-endosomal protein that contains a conserved MENTAL (MLN64 N-terminal) domain. The encoded protein binds cholesterol molecules and may play a role in endosomal cholesterol transport through interactions with metastatic lymph node protein 64 (MLN64). [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Stard3nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01907:Stard3nl APN 13 19372589 missense probably damaging 1.00
IGL03080:Stard3nl APN 13 19370478 critical splice donor site probably null
R0838:Stard3nl UTSW 13 19372586 critical splice donor site probably null
R1436:Stard3nl UTSW 13 19372649 missense probably damaging 1.00
R1625:Stard3nl UTSW 13 19372584 splice site probably null
R4599:Stard3nl UTSW 13 19367753 missense probably damaging 1.00
R4609:Stard3nl UTSW 13 19370264 missense probably damaging 0.98
R4667:Stard3nl UTSW 13 19376519 missense probably damaging 1.00
R4668:Stard3nl UTSW 13 19376519 missense probably damaging 1.00
R4669:Stard3nl UTSW 13 19376519 missense probably damaging 1.00
R4740:Stard3nl UTSW 13 19367778 missense probably benign 0.34
R4740:Stard3nl UTSW 13 19376566 missense probably damaging 0.99
R7633:Stard3nl UTSW 13 19367838 missense probably damaging 1.00
R7673:Stard3nl UTSW 13 19367753 missense probably benign 0.32
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-06