Incidental Mutation 'R4360:Slc18a3'
ID 324870
Institutional Source Beutler Lab
Gene Symbol Slc18a3
Ensembl Gene ENSMUSG00000100241
Gene Name solute carrier family 18 (vesicular monoamine), member 3
Synonyms VAT, VAChT
MMRRC Submission 041111-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R4360 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 32184395-32186807 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32185882 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 167 (V167A)
Ref Sequence ENSEMBL: ENSMUSP00000139829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070125] [ENSMUST00000191501] [ENSMUST00000226351] [ENSMUST00000226365] [ENSMUST00000227579] [ENSMUST00000228420] [ENSMUST00000228511] [ENSMUST00000228256]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070125
SMART Domains Protein: ENSMUSP00000070865
Gene: ENSMUSG00000021919

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 24 612 5.5e-190 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180662
Predicted Effect probably benign
Transcript: ENSMUST00000191501
AA Change: V167A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139829
Gene: ENSMUSG00000100241
AA Change: V167A

DomainStartEndE-ValueType
Pfam:MFS_1 35 415 3.1e-32 PFAM
Pfam:Sugar_tr 83 268 3.3e-8 PFAM
transmembrane domain 416 438 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226351
Predicted Effect probably benign
Transcript: ENSMUST00000226365
Predicted Effect probably benign
Transcript: ENSMUST00000227579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227675
Predicted Effect probably benign
Transcript: ENSMUST00000228420
Predicted Effect probably benign
Transcript: ENSMUST00000228511
Predicted Effect probably benign
Transcript: ENSMUST00000228256
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the vesicular amine transporter family. The encoded transmembrane protein transports acetylcholine into secretory vesicles for release into the extracellular space. Acetylcholine transport utilizes a proton gradient established by a vacuolar ATPase. This gene is located within the first intron of the choline acetyltransferase gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased acetylcholine release, grip strength, coordination, exercise endurance, and social recognition memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 67,175,850 (GRCm39) noncoding transcript Het
Adgra3 T C 5: 50,147,552 (GRCm39) E496G possibly damaging Het
Atg14 C G 14: 47,805,827 (GRCm39) E13Q probably benign Het
BC023105 G T 18: 60,575,073 (GRCm39) noncoding transcript Het
Chd6 A G 2: 160,791,776 (GRCm39) V2527A possibly damaging Het
Csn1s2a G T 5: 87,929,700 (GRCm39) V100L possibly damaging Het
Fah G A 7: 84,238,856 (GRCm39) L330F probably damaging Het
Fmo2 T C 1: 162,709,583 (GRCm39) N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,431,475 (GRCm39) probably benign Het
Frmd4a A T 2: 4,606,052 (GRCm39) H287L probably damaging Het
G2e3 T A 12: 51,410,197 (GRCm39) probably benign Het
Gm1758 A T 16: 14,324,215 (GRCm39) noncoding transcript Het
Gm7204 T C 16: 48,039,196 (GRCm39) noncoding transcript Het
Gm829 T C 4: 45,718,819 (GRCm39) noncoding transcript Het
Hspa14 A G 2: 3,503,560 (GRCm39) V116A possibly damaging Het
Hspa4 T C 11: 53,155,919 (GRCm39) Y662C probably damaging Het
Islr T A 9: 58,064,887 (GRCm39) N207Y probably damaging Het
Lipc T C 9: 70,759,864 (GRCm39) probably benign Het
Ncor2 A G 5: 125,106,036 (GRCm39) S1546P probably damaging Het
Or13a25 T C 7: 140,247,730 (GRCm39) F170L probably damaging Het
Or56a3 A C 7: 104,735,460 (GRCm39) E179A probably damaging Het
Or7g18 G A 9: 18,787,013 (GRCm39) C127Y probably damaging Het
Parp4 A G 14: 56,866,661 (GRCm39) D1075G possibly damaging Het
Pkp2 A G 16: 16,086,546 (GRCm39) I736V probably benign Het
Plekha8 T C 6: 54,599,171 (GRCm39) I235T probably benign Het
Polq A G 16: 36,880,701 (GRCm39) D955G probably benign Het
Pramel16 A G 4: 143,677,433 (GRCm39) F49L possibly damaging Het
Psmd1 A G 1: 86,061,459 (GRCm39) K890E probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scpep1 A G 11: 88,821,070 (GRCm39) Y366H possibly damaging Het
Sp8 A G 12: 118,812,400 (GRCm39) D85G possibly damaging Het
Stard3nl G A 13: 19,554,654 (GRCm39) S144L probably damaging Het
Stk4 A G 2: 163,930,879 (GRCm39) E160G possibly damaging Het
Tbcb T C 7: 29,926,460 (GRCm39) N119S probably benign Het
Tnc G T 4: 63,935,161 (GRCm39) R592S probably benign Het
Trem3 T A 17: 48,556,801 (GRCm39) S91T probably benign Het
Trpc6 A G 9: 8,610,267 (GRCm39) E245G probably benign Het
Usp40 C T 1: 87,880,083 (GRCm39) R1036H probably damaging Het
Usp47 G T 7: 111,654,139 (GRCm39) G112C probably damaging Het
Wdr35 T C 12: 9,024,149 (GRCm39) probably benign Het
Zc3h14 A G 12: 98,746,456 (GRCm39) K555R probably benign Het
Zfp26 T C 9: 20,349,869 (GRCm39) S232G probably benign Het
Zfp811 T C 17: 33,017,432 (GRCm39) T202A probably benign Het
Other mutations in Slc18a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02938:Slc18a3 APN 14 32,185,772 (GRCm39) missense probably damaging 1.00
IGL03336:Slc18a3 APN 14 32,184,785 (GRCm39) intron probably benign
R3153:Slc18a3 UTSW 14 32,185,228 (GRCm39) missense probably benign 0.01
R5001:Slc18a3 UTSW 14 32,185,736 (GRCm39) missense possibly damaging 0.61
R5257:Slc18a3 UTSW 14 32,185,777 (GRCm39) missense probably damaging 1.00
R5271:Slc18a3 UTSW 14 32,185,705 (GRCm39) missense probably damaging 1.00
R5316:Slc18a3 UTSW 14 32,184,814 (GRCm39) missense probably benign
R5846:Slc18a3 UTSW 14 32,185,880 (GRCm39) missense probably benign
R6696:Slc18a3 UTSW 14 32,186,270 (GRCm39) missense possibly damaging 0.89
R9322:Slc18a3 UTSW 14 32,185,282 (GRCm39) missense probably benign 0.00
R9473:Slc18a3 UTSW 14 32,185,913 (GRCm39) missense probably benign 0.09
Z1176:Slc18a3 UTSW 14 32,185,079 (GRCm39) missense probably damaging 1.00
Z1177:Slc18a3 UTSW 14 32,186,285 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCAAAGCTGATGAAGGCTAGCG -3'
(R):5'- TAATGCCAGCGCCTACTTGG -3'

Sequencing Primer
(F):5'- GATACTTGTCGGCGATCA -3'
(R):5'- TACTTGGCCAACACCTCGG -3'
Posted On 2015-07-06