Incidental Mutation 'R4360:Atg14'
ID324871
Institutional Source Beutler Lab
Gene Symbol Atg14
Ensembl Gene ENSMUSG00000037526
Gene Nameautophagy related 14
SynonymsBarkor, D14Ertd436e, D14Ertd114e
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R4360 (G1)
Quality Score131
Status Validated
Chromosome14
Chromosomal Location47540893-47570649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 47568370 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 13 (E13Q)
Ref Sequence ENSEMBL: ENSMUSP00000153718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042988] [ENSMUST00000226299]
Predicted Effect probably benign
Transcript: ENSMUST00000042988
AA Change: E13Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000039047
Gene: ENSMUSG00000037526
AA Change: E13Q

DomainStartEndE-ValueType
Pfam:Atg14 43 393 1.1e-79 PFAM
low complexity region 447 464 N/A INTRINSIC
low complexity region 465 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226299
AA Change: E13Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect unknown
Transcript: ENSMUST00000228784
AA Change: E12Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228790
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele following delivery of a Tat-cre exhibit increased mucin accumulation in colonic epithelial spheroids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Atg14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Atg14 APN 14 47542859 missense probably benign 0.00
IGL02513:Atg14 APN 14 47548994 missense probably benign 0.03
IGL02513:Atg14 APN 14 47545624 splice site probably benign
PIT4243001:Atg14 UTSW 14 47554574 missense possibly damaging 0.77
R1463:Atg14 UTSW 14 47548994 missense probably benign 0.03
R1479:Atg14 UTSW 14 47547239 critical splice donor site probably null
R1499:Atg14 UTSW 14 47560645 missense probably benign
R1781:Atg14 UTSW 14 47549150 critical splice acceptor site probably null
R1974:Atg14 UTSW 14 47545841 missense probably damaging 1.00
R2089:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2091:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2091:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2113:Atg14 UTSW 14 47551324 missense probably damaging 1.00
R4231:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4232:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4233:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4234:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4236:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4711:Atg14 UTSW 14 47545841 missense probably damaging 1.00
R4883:Atg14 UTSW 14 47551314 missense probably damaging 1.00
R5025:Atg14 UTSW 14 47545816 missense probably damaging 1.00
R5235:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5250:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5297:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5301:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5338:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5450:Atg14 UTSW 14 47551464 missense probably benign
R5475:Atg14 UTSW 14 47568336 missense possibly damaging 0.83
R5799:Atg14 UTSW 14 47547295 missense possibly damaging 0.63
R6489:Atg14 UTSW 14 47549023 missense probably damaging 0.97
R7589:Atg14 UTSW 14 47543090 missense probably benign 0.00
R7908:Atg14 UTSW 14 47568593 unclassified probably benign
Z1088:Atg14 UTSW 14 47568292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAAAGCAGCTCCATTCTC -3'
(R):5'- TAGATTCTCCGCCTCTGAGC -3'

Sequencing Primer
(F):5'- TTTCCACACTCGCAGGGC -3'
(R):5'- TCCGCCTCTGAGCTCCAG -3'
Posted On2015-07-06