Incidental Mutation 'R4360:Pkp2'
ID324876
Institutional Source Beutler Lab
Gene Symbol Pkp2
Ensembl Gene ENSMUSG00000041957
Gene Nameplakophilin 2
Synonyms1200008D14Rik, Pkp2l, 1200012P04Rik
MMRRC Submission 041111-MU
Accession Numbers

NCBI RefSeq: NM_026163.2; MGI: 1914701

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4360 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16213318-16272712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16268682 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 736 (I736V)
Ref Sequence ENSEMBL: ENSMUSP00000036890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039408]
Predicted Effect probably benign
Transcript: ENSMUST00000039408
AA Change: I736V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000036890
Gene: ENSMUSG00000041957
AA Change: I736V

DomainStartEndE-ValueType
low complexity region 258 271 N/A INTRINSIC
ARM 342 382 7.5e-9 SMART
ARM 384 425 5.14e-7 SMART
Blast:ARM 426 481 2e-29 BLAST
ARM 484 530 8.76e-1 SMART
ARM 631 672 2.98e-3 SMART
Blast:ARM 677 718 2e-11 BLAST
Blast:ARM 720 763 5e-17 BLAST
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype Strain: 3487374
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene product may regulate the signaling activity of beta-catenin. Two alternately spliced transcripts encoding two protein isoforms have been identified. A processed pseudogene with high similarity to this locus has been mapped to chromosome 12p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with impaired heart formation, hemopericardium, and hemoperitoneum. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(2) Gene trapped(4)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Pkp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0014:Pkp2 UTSW 16 16240522 missense probably benign 0.08
R0131:Pkp2 UTSW 16 16240713 splice site probably benign
R0581:Pkp2 UTSW 16 16269783 splice site probably benign
R0722:Pkp2 UTSW 16 16247028 missense probably benign
R0882:Pkp2 UTSW 16 16269711 missense probably damaging 1.00
R0942:Pkp2 UTSW 16 16226030 missense probably benign
R1236:Pkp2 UTSW 16 16225902 missense probably benign
R1265:Pkp2 UTSW 16 16225304 missense probably benign 0.00
R1674:Pkp2 UTSW 16 16240558 missense possibly damaging 0.50
R1687:Pkp2 UTSW 16 16268709 critical splice donor site probably null
R1769:Pkp2 UTSW 16 16262697 missense probably damaging 1.00
R2094:Pkp2 UTSW 16 16246967 missense probably damaging 1.00
R4739:Pkp2 UTSW 16 16230724 missense probably damaging 0.99
R5162:Pkp2 UTSW 16 16260336 missense probably damaging 1.00
R5607:Pkp2 UTSW 16 16260375 missense probably damaging 0.98
R6334:Pkp2 UTSW 16 16226069 missense probably damaging 0.99
R6918:Pkp2 UTSW 16 16272218 missense probably damaging 1.00
R7274:Pkp2 UTSW 16 16246929 missense possibly damaging 0.92
R7408:Pkp2 UTSW 16 16261673 missense possibly damaging 0.50
R7698:Pkp2 UTSW 16 16240659 missense probably benign 0.01
R7788:Pkp2 UTSW 16 16225408 missense probably benign 0.01
R8030:Pkp2 UTSW 16 16246910 missense probably benign
R8056:Pkp2 UTSW 16 16213400 missense probably benign 0.28
Z1176:Pkp2 UTSW 16 16230700 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTTCTCCCATGTGCTGTAAC -3'
(R):5'- AACTAGAGAAGCTGCAGCCC -3'

Sequencing Primer
(F):5'- ACATACATGTTCTCCCAAAGGG -3'
(R):5'- GCAGCCCTGGTCTGTGATACTAC -3'
Posted On2015-07-06