Incidental Mutation 'R4360:Polq'
ID 324877
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Name polymerase (DNA directed), theta
Synonyms A430110D14Rik
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R4360 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 37011786-37095417 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37060339 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 955 (D955G)
Ref Sequence ENSEMBL: ENSMUSP00000059757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
AlphaFold Q8CGS6
Predicted Effect probably benign
Transcript: ENSMUST00000054034
AA Change: D955G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: D955G

low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071452
AA Change: D676G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: D676G

low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182622
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 37065247 splice site probably benign
IGL00539:Polq APN 16 37060569 missense probably damaging 0.98
IGL00960:Polq APN 16 37060512 missense probably damaging 0.96
IGL01100:Polq APN 16 37061112 missense probably benign
IGL01112:Polq APN 16 37017309 missense probably damaging 1.00
IGL01138:Polq APN 16 37045869 missense possibly damaging 0.94
IGL01432:Polq APN 16 37071822 splice site probably benign
IGL01522:Polq APN 16 37027903 missense probably damaging 1.00
IGL01565:Polq APN 16 37013113 missense probably benign 0.00
IGL01592:Polq APN 16 37034850 missense probably benign 0.01
IGL01690:Polq APN 16 37062838 missense probably damaging 0.97
IGL01943:Polq APN 16 37061443 missense possibly damaging 0.47
IGL02531:Polq APN 16 37062374 missense possibly damaging 0.75
IGL02553:Polq APN 16 37041768 missense probably damaging 1.00
IGL02623:Polq APN 16 37060375 missense probably benign 0.04
IGL02692:Polq APN 16 37060627 missense probably damaging 1.00
IGL02717:Polq APN 16 37022740 missense probably damaging 1.00
IGL02937:Polq APN 16 37013109 missense probably benign 0.14
IGL02959:Polq APN 16 37086566 missense probably damaging 1.00
IGL03086:Polq APN 16 37091049 missense probably benign 0.02
IGL03141:Polq APN 16 37017358 splice site probably benign
IGL03302:Polq APN 16 37071772 missense probably damaging 1.00
IGL03393:Polq APN 16 37044794 missense probably damaging 1.00
R0013_Polq_667 UTSW 16 37061839 missense possibly damaging 0.56
R4238_Polq_233 UTSW 16 37013181 missense probably damaging 1.00
R4280_polq_867 UTSW 16 37082057 missense probably damaging 1.00
G1Funyon:Polq UTSW 16 37061819 missense probably damaging 1.00
PIT4403001:Polq UTSW 16 37060587 missense probably benign 0.00
R0013:Polq UTSW 16 37061839 missense possibly damaging 0.56
R0082:Polq UTSW 16 37017257 missense probably benign 0.01
R0212:Polq UTSW 16 37066854 missense probably damaging 0.99
R0387:Polq UTSW 16 37029430 missense probably damaging 1.00
R0387:Polq UTSW 16 37089317 missense probably damaging 1.00
R0427:Polq UTSW 16 37061993 nonsense probably null
R0454:Polq UTSW 16 37034890 missense probably damaging 0.98
R0513:Polq UTSW 16 37094502 missense probably damaging 1.00
R0622:Polq UTSW 16 37060993 missense probably benign 0.02
R0848:Polq UTSW 16 37062130 missense probably benign 0.08
R1142:Polq UTSW 16 37013217 missense probably damaging 0.98
R1218:Polq UTSW 16 37029446 missense possibly damaging 0.93
R1331:Polq UTSW 16 37041747 missense probably damaging 1.00
R1398:Polq UTSW 16 37062495 missense possibly damaging 0.87
R1424:Polq UTSW 16 37086528 missense probably damaging 1.00
R1644:Polq UTSW 16 37060264 missense probably damaging 0.96
R1777:Polq UTSW 16 37060224 missense possibly damaging 0.94
R1820:Polq UTSW 16 37029418 missense possibly damaging 0.48
R1854:Polq UTSW 16 37062109 missense probably benign 0.01
R1880:Polq UTSW 16 37086592 missense possibly damaging 0.90
R1932:Polq UTSW 16 37062304 missense possibly damaging 0.92
R2008:Polq UTSW 16 37062482 missense probably damaging 0.96
R2014:Polq UTSW 16 37078366 missense probably damaging 1.00
R2026:Polq UTSW 16 37062745 missense possibly damaging 0.93
R2178:Polq UTSW 16 37062829 missense probably damaging 1.00
R2259:Polq UTSW 16 37062097 missense probably benign 0.03
R2266:Polq UTSW 16 37062153 missense possibly damaging 0.59
R2305:Polq UTSW 16 37062337 missense probably damaging 0.99
R2370:Polq UTSW 16 37073939 missense probably damaging 1.00
R2504:Polq UTSW 16 37011942 missense unknown
R2517:Polq UTSW 16 37089325 missense probably damaging 1.00
R2697:Polq UTSW 16 37042153 missense probably damaging 1.00
R2858:Polq UTSW 16 37062753 missense possibly damaging 0.88
R3436:Polq UTSW 16 37062337 missense probably damaging 0.99
R3437:Polq UTSW 16 37062337 missense probably damaging 0.99
R3699:Polq UTSW 16 37042156 missense probably damaging 1.00
R3838:Polq UTSW 16 37078349 missense probably damaging 1.00
R3875:Polq UTSW 16 37074027 missense probably damaging 0.99
R4050:Polq UTSW 16 37092820 critical splice acceptor site probably null
R4172:Polq UTSW 16 37060758 missense probably benign 0.02
R4238:Polq UTSW 16 37013181 missense probably damaging 1.00
R4240:Polq UTSW 16 37013181 missense probably damaging 1.00
R4280:Polq UTSW 16 37082057 missense probably damaging 1.00
R4296:Polq UTSW 16 37061301 missense possibly damaging 0.94
R4373:Polq UTSW 16 37013181 missense probably damaging 1.00
R4375:Polq UTSW 16 37013181 missense probably damaging 1.00
R4376:Polq UTSW 16 37013181 missense probably damaging 1.00
R4509:Polq UTSW 16 37048563 missense probably damaging 1.00
R4510:Polq UTSW 16 37048563 missense probably damaging 1.00
R4511:Polq UTSW 16 37048563 missense probably damaging 1.00
R4543:Polq UTSW 16 37060785 missense probably benign 0.43
R4633:Polq UTSW 16 37048542 missense probably damaging 1.00
R4739:Polq UTSW 16 37041747 missense probably damaging 1.00
R4834:Polq UTSW 16 37027814 missense probably damaging 1.00
R4841:Polq UTSW 16 37048783 critical splice donor site probably null
R4842:Polq UTSW 16 37048783 critical splice donor site probably null
R4937:Polq UTSW 16 37027912 missense probably benign 0.01
R4955:Polq UTSW 16 37061082 missense probably benign 0.32
R4992:Polq UTSW 16 37061162 missense possibly damaging 0.59
R5008:Polq UTSW 16 37062387 missense probably benign
R5221:Polq UTSW 16 37042178 missense probably damaging 0.98
R5254:Polq UTSW 16 37089319 missense probably damaging 1.00
R5292:Polq UTSW 16 37061383 missense probably damaging 1.00
R5375:Polq UTSW 16 37082784 missense probably damaging 1.00
R5480:Polq UTSW 16 37013290 splice site probably benign
R5552:Polq UTSW 16 37094510 missense possibly damaging 0.93
R5591:Polq UTSW 16 37011885 utr 5 prime probably benign
R5653:Polq UTSW 16 37040534 missense probably damaging 1.00
R5708:Polq UTSW 16 37061018 missense probably damaging 0.98
R5754:Polq UTSW 16 37017263 missense probably benign
R5757:Polq UTSW 16 37086681 missense probably benign 0.01
R5764:Polq UTSW 16 37017344 missense probably damaging 0.97
R6019:Polq UTSW 16 37061764 missense probably damaging 1.00
R6170:Polq UTSW 16 37045812 missense possibly damaging 0.82
R6177:Polq UTSW 16 37071709 missense probably damaging 0.98
R6307:Polq UTSW 16 37017356 critical splice donor site probably null
R6499:Polq UTSW 16 37060827 missense probably benign 0.03
R6520:Polq UTSW 16 37060377 missense possibly damaging 0.88
R6598:Polq UTSW 16 37061631 missense probably benign 0.39
R6694:Polq UTSW 16 37015173 missense probably null 0.99
R6788:Polq UTSW 16 37077148 missense probably damaging 1.00
R7104:Polq UTSW 16 37089353 nonsense probably null
R7159:Polq UTSW 16 37062853 missense possibly damaging 0.87
R7222:Polq UTSW 16 37086633 nonsense probably null
R7340:Polq UTSW 16 37060926 missense probably benign 0.00
R7361:Polq UTSW 16 37060428 missense probably benign 0.00
R7384:Polq UTSW 16 37029418 missense probably damaging 1.00
R7509:Polq UTSW 16 37060343 missense probably benign
R7509:Polq UTSW 16 37060344 missense probably benign 0.00
R7575:Polq UTSW 16 37091134 missense probably benign 0.00
R7785:Polq UTSW 16 37027877 missense probably damaging 1.00
R7787:Polq UTSW 16 37017309 missense probably damaging 1.00
R7891:Polq UTSW 16 37027882 missense probably damaging 1.00
R7898:Polq UTSW 16 37044883 missense probably damaging 0.98
R7917:Polq UTSW 16 37065288 missense probably benign 0.08
R7940:Polq UTSW 16 37060642 missense probably benign 0.27
R8028:Polq UTSW 16 37061316 missense possibly damaging 0.82
R8114:Polq UTSW 16 37042215 missense possibly damaging 0.94
R8144:Polq UTSW 16 37029484 missense probably benign 0.01
R8288:Polq UTSW 16 37027910 missense probably damaging 1.00
R8301:Polq UTSW 16 37061819 missense probably damaging 1.00
R8341:Polq UTSW 16 37071771 missense possibly damaging 0.96
R8348:Polq UTSW 16 37017197 critical splice acceptor site probably null
R8448:Polq UTSW 16 37017197 critical splice acceptor site probably null
R8815:Polq UTSW 16 37033531 missense probably damaging 1.00
R8843:Polq UTSW 16 37011918 missense unknown
R8878:Polq UTSW 16 37040507 missense probably benign 0.02
R9016:Polq UTSW 16 37022797 missense probably damaging 1.00
R9189:Polq UTSW 16 37044903 missense probably damaging 1.00
R9209:Polq UTSW 16 37048649 missense possibly damaging 0.94
R9352:Polq UTSW 16 37041890 missense probably damaging 0.98
R9398:Polq UTSW 16 37061032 missense probably benign 0.02
R9403:Polq UTSW 16 37061853 missense probably benign 0.00
R9489:Polq UTSW 16 37022811 missense probably benign 0.00
R9605:Polq UTSW 16 37022811 missense probably benign 0.00
R9664:Polq UTSW 16 37027814 missense probably damaging 0.98
R9801:Polq UTSW 16 37092828 missense probably damaging 1.00
X0060:Polq UTSW 16 37017237 nonsense probably null
Z1176:Polq UTSW 16 37042257 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-07-06