Incidental Mutation 'R4360:Zfp811'
ID324879
Institutional Source Beutler Lab
Gene Symbol Zfp811
Ensembl Gene ENSMUSG00000055202
Gene Namezinc finger protein 811
Synonyms
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4360 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32795676-32809853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32798458 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 202 (T202A)
Ref Sequence ENSEMBL: ENSMUSP00000079709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080905] [ENSMUST00000200914]
Predicted Effect probably benign
Transcript: ENSMUST00000080905
AA Change: T202A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000079709
Gene: ENSMUSG00000055202
AA Change: T202A

DomainStartEndE-ValueType
KRAB 3 62 6.26e-16 SMART
ZnF_C2H2 192 215 1.25e-1 SMART
ZnF_C2H2 220 242 1.79e-2 SMART
ZnF_C2H2 248 270 9.08e-4 SMART
ZnF_C2H2 276 298 7.78e-3 SMART
ZnF_C2H2 304 326 3.69e-4 SMART
ZnF_C2H2 332 354 8.47e-4 SMART
ZnF_C2H2 360 382 1.45e-2 SMART
ZnF_C2H2 388 410 6.42e-4 SMART
ZnF_C2H2 416 438 5.9e-3 SMART
ZnF_C2H2 444 466 1.08e-1 SMART
ZnF_C2H2 472 494 2.75e-3 SMART
ZnF_C2H2 500 522 9.44e-2 SMART
ZnF_C2H2 528 551 3.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104150
Predicted Effect probably benign
Transcript: ENSMUST00000200914
AA Change: T203A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144038
Gene: ENSMUSG00000055202
AA Change: T203A

DomainStartEndE-ValueType
KRAB 4 63 2.6e-18 SMART
ZnF_C2H2 193 216 5.4e-4 SMART
ZnF_C2H2 221 243 7.8e-5 SMART
ZnF_C2H2 249 271 3.8e-6 SMART
ZnF_C2H2 277 299 3.3e-5 SMART
ZnF_C2H2 305 327 1.6e-6 SMART
ZnF_C2H2 333 355 3.8e-6 SMART
ZnF_C2H2 361 383 6.1e-5 SMART
ZnF_C2H2 389 411 2.7e-6 SMART
ZnF_C2H2 417 439 2.5e-5 SMART
ZnF_C2H2 445 467 4.6e-4 SMART
ZnF_C2H2 473 495 1.2e-5 SMART
ZnF_C2H2 501 523 4e-4 SMART
ZnF_C2H2 529 552 1.7e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Other mutations in Zfp811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zfp811 APN 17 32797820 missense probably damaging 1.00
IGL02227:Zfp811 APN 17 32798642 nonsense probably null
IGL02529:Zfp811 APN 17 32797815 missense probably damaging 1.00
IGL03190:Zfp811 APN 17 32798881 splice site probably benign
R0112:Zfp811 UTSW 17 32797764 missense probably damaging 0.96
R1025:Zfp811 UTSW 17 32798644 missense probably benign 0.00
R1522:Zfp811 UTSW 17 32797648 missense probably damaging 1.00
R1829:Zfp811 UTSW 17 32798142 missense possibly damaging 0.72
R1861:Zfp811 UTSW 17 32797425 missense probably damaging 1.00
R2181:Zfp811 UTSW 17 32797721 missense probably damaging 0.96
R4425:Zfp811 UTSW 17 32797547 nonsense probably null
R4657:Zfp811 UTSW 17 32800923 nonsense probably null
R6066:Zfp811 UTSW 17 32798827 missense possibly damaging 0.73
R6109:Zfp811 UTSW 17 32797374 unclassified probably null
R6702:Zfp811 UTSW 17 32797842 missense probably damaging 1.00
R6714:Zfp811 UTSW 17 32797762 missense probably damaging 1.00
R6826:Zfp811 UTSW 17 32797788 missense probably damaging 1.00
R6983:Zfp811 UTSW 17 32797432 nonsense probably null
R7276:Zfp811 UTSW 17 32798781 missense probably benign 0.00
R7343:Zfp811 UTSW 17 32797513 missense probably damaging 0.98
R7432:Zfp811 UTSW 17 32798759 missense possibly damaging 0.73
R7523:Zfp811 UTSW 17 32797752 missense probably benign 0.10
R7894:Zfp811 UTSW 17 32798847 missense possibly damaging 0.85
R7977:Zfp811 UTSW 17 32798847 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACACCGCTGTGAACTATTTTATGC -3'
(R):5'- TGTGTATACTAAGGAATCTCAGGGC -3'

Sequencing Primer
(F):5'- GGTAATGAAGGCTTTCCCACACTG -3'
(R):5'- GGCACCTCCAGCGCTTC -3'
Posted On2015-07-06