Incidental Mutation 'R0010:Myl3'
ID32490
Institutional Source Beutler Lab
Gene Symbol Myl3
Ensembl Gene ENSMUSG00000059741
Gene Namemyosin, light polypeptide 3
SynonymsMLC1v, alkali, slow skeletal, MLC1s, Mylc, ventricular
MMRRC Submission 038305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R0010 (G1)
Quality Score197
Status Validated (trace)
Chromosome9
Chromosomal Location110741861-110769798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 110767929 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 119 (D119A)
Ref Sequence ENSEMBL: ENSMUSP00000142530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079784] [ENSMUST00000124267] [ENSMUST00000136695] [ENSMUST00000200011]
Predicted Effect probably damaging
Transcript: ENSMUST00000079784
AA Change: D119A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078715
Gene: ENSMUSG00000059741
AA Change: D119A

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
internal_repeat_1 61 124 1.28e-5 PROSPERO
internal_repeat_1 140 198 1.28e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000124267
AA Change: D42A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142424
Gene: ENSMUSG00000059741
AA Change: D42A

DomainStartEndE-ValueType
SCOP:d1ggwa_ 1 127 2e-23 SMART
PDB:1W7J|B 2 126 3e-68 PDB
Blast:EFh 64 92 5e-12 BLAST
Blast:EFh 99 126 2e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000136695
AA Change: D42A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142791
Gene: ENSMUSG00000059741
AA Change: D42A

DomainStartEndE-ValueType
SCOP:d1ggwa_ 1 127 2e-23 SMART
PDB:1W7J|B 2 126 3e-68 PDB
Blast:EFh 64 92 5e-12 BLAST
Blast:EFh 99 126 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153142
Predicted Effect probably damaging
Transcript: ENSMUST00000200011
AA Change: D119A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142530
Gene: ENSMUSG00000059741
AA Change: D119A

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:EF-hand_6 62 93 4.7e-3 PFAM
internal_repeat_1 140 182 5.24e-5 PROSPERO
Meta Mutation Damage Score 0.3993 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYL3 encodes myosin light chain 3, an alkali light chain also referred to in the literature as both the ventricular isoform and the slow skeletal muscle isoform. Mutations in MYL3 have been identified as a cause of mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,205,609 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Bbs7 T C 3: 36,607,717 probably null Het
BC037034 T C 5: 138,260,293 probably null Het
Cacna1h T C 17: 25,380,844 K1566E probably damaging Het
Ccdc73 C T 2: 104,980,987 probably benign Het
Cd74 A T 18: 60,803,896 probably benign Het
Cd74 A T 18: 60,809,071 H124L probably benign Het
Cdk5rap2 T C 4: 70,243,459 E270G probably benign Het
Ces2a G A 8: 104,741,396 D520N probably benign Het
Cldnd1 T A 16: 58,731,259 probably benign Het
Cox17 T A 16: 38,347,170 C24S possibly damaging Het
Cyp2b9 T A 7: 26,186,753 probably benign Het
Dennd4a T C 9: 64,896,715 L1112P probably benign Het
Dennd4c T C 4: 86,781,577 S222P probably damaging Het
Dhx37 T A 5: 125,431,616 Q85L probably benign Het
Egfem1 G T 3: 29,582,919 C192F probably damaging Het
Eif3f A T 7: 108,941,005 N336Y possibly damaging Het
Evc2 T A 5: 37,417,449 L1016Q probably damaging Het
Fam114a2 G T 11: 57,514,156 T40N probably damaging Het
Fam135b T C 15: 71,622,032 K16R probably damaging Het
Fcho1 A G 8: 71,709,999 Y725H probably damaging Het
Frem1 T C 4: 83,000,098 I536V probably benign Het
Ginm1 T C 10: 7,775,374 probably benign Het
Glrb A T 3: 80,860,315 probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10320 T C 13: 98,489,546 Y110C probably damaging Het
Gm20388 G A 8: 122,270,598 probably benign Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm5422 A G 10: 31,249,754 noncoding transcript Het
Igkv6-29 A T 6: 70,138,770 probably benign Het
Inpp5d G A 1: 87,697,546 probably null Het
Itpr3 T G 17: 27,120,977 V2610G probably damaging Het
Kmt5c T A 7: 4,746,208 M88K probably benign Het
Lrp12 C T 15: 39,878,276 A367T probably damaging Het
Ltbp1 A G 17: 75,363,391 T1476A probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Milr1 T G 11: 106,767,003 *209G probably null Het
Mitf A G 6: 97,807,281 K33R probably benign Het
Mon2 A C 10: 123,032,694 S485A probably damaging Het
Mpdu1 C T 11: 69,658,841 G47R probably damaging Het
Ms4a4d A G 19: 11,554,826 N112S probably damaging Het
Mybpc3 G A 2: 91,134,833 W1082* probably null Het
Naa15 A T 3: 51,436,213 probably null Het
Nav3 A G 10: 109,823,226 probably benign Het
Nek7 T A 1: 138,544,204 Q66L possibly damaging Het
Nktr G A 9: 121,741,166 probably benign Het
Nlgn1 G T 3: 25,435,842 probably benign Het
Npr1 T C 3: 90,454,832 E1002G probably damaging Het
Nup133 A T 8: 123,904,579 I1072N probably damaging Het
Oc90 C T 15: 65,876,548 C371Y probably damaging Het
Olfr835 A T 9: 19,035,322 L66F probably damaging Het
Olfr901 A T 9: 38,430,920 I213F possibly damaging Het
Olfr994 A T 2: 85,429,895 D311E probably benign Het
Pradc1 A T 6: 85,447,231 N44K probably damaging Het
Pradc1 T C 6: 85,447,620 D116G probably damaging Het
Ptprk G A 10: 28,585,969 C91Y probably damaging Het
Pus7 T C 5: 23,747,845 I491V probably benign Het
Rock1 T A 18: 10,084,380 D951V probably damaging Het
Scgb2b26 T A 7: 33,944,349 E55D probably damaging Het
Scn8a T C 15: 101,013,573 V958A probably damaging Het
Sec14l1 T C 11: 117,143,770 probably benign Het
Sec24c A G 14: 20,689,261 probably benign Het
Sema6b C T 17: 56,124,105 E853K probably benign Het
Sgk1 G A 10: 21,997,438 probably null Het
Shprh C T 10: 11,151,931 T94I probably benign Het
Slc16a3 T C 11: 120,956,705 S240P probably benign Het
Slc5a8 T C 10: 88,886,590 V95A probably benign Het
Smg1 A T 7: 118,171,859 probably benign Het
Spta1 G A 1: 174,217,943 V1556I probably benign Het
Svs1 A T 6: 48,988,906 H616L probably damaging Het
Trappc4 G A 9: 44,405,231 probably benign Het
Tubgcp6 A G 15: 89,103,183 S1188P probably benign Het
Txlna T G 4: 129,629,086 D487A probably benign Het
Ube2d2b T C 5: 107,830,636 F51S possibly damaging Het
Vmn2r6 G A 3: 64,559,545 Q178* probably null Het
Wdfy3 T C 5: 101,848,349 T3234A probably damaging Het
Ylpm1 C A 12: 85,029,026 Q384K probably damaging Het
Zbtb41 T G 1: 139,423,530 V127G probably damaging Het
Zfp605 T A 5: 110,127,534 C173S probably benign Het
Zfp608 A T 18: 54,895,214 probably benign Het
Zhx2 T C 15: 57,821,274 V13A possibly damaging Het
Other mutations in Myl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Myl3 APN 9 110766489 missense possibly damaging 0.95
IGL01292:Myl3 APN 9 110767977 missense probably damaging 1.00
IGL02814:Myl3 APN 9 110767991 nonsense probably null
R0009:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0015:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0040:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0045:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0045:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0080:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0081:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0095:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0194:Myl3 UTSW 9 110769121 missense probably benign 0.00
R1938:Myl3 UTSW 9 110766734 missense probably damaging 1.00
R2230:Myl3 UTSW 9 110767911 missense probably damaging 1.00
R2231:Myl3 UTSW 9 110767911 missense probably damaging 1.00
R2315:Myl3 UTSW 9 110766741 missense probably damaging 1.00
R3884:Myl3 UTSW 9 110767959 missense probably damaging 1.00
R5473:Myl3 UTSW 9 110767958 missense probably damaging 1.00
R7059:Myl3 UTSW 9 110742037 splice site probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGGCGTTCCTAAGTAGACCATC -3'
(R):5'- TGGTCAAGTGACACAAAGGTTTCCC -3'

Sequencing Primer
(F):5'- GTTCCTAAGTAGACCATCAGGGC -3'
(R):5'- CTAGGACATCCCAGAGAAAGAG -3'
Posted On2013-05-09