Incidental Mutation 'R4361:Myom2'
ID324915
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Namemyomesin 2
Synonyms
MMRRC Submission 041112-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4361 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location15057653-15133541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 15112018 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 984 (V984I)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033842
AA Change: V984I

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: V984I

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135393
Meta Mutation Damage Score 0.3113 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,706 T538A probably damaging Het
1700027J19Rik A G 7: 4,151,780 V3A possibly damaging Het
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Aadac T A 3: 60,039,761 S293R probably benign Het
Cc2d1b G A 4: 108,624,750 probably benign Het
Ccdc157 C T 11: 4,146,550 A400T probably damaging Het
Cyp11b1 T A 15: 74,839,016 M232L possibly damaging Het
Dhrs2 G A 14: 55,241,189 D264N probably damaging Het
Dram2 T C 3: 106,566,215 probably benign Het
Dtx4 C A 19: 12,485,296 S373I probably benign Het
Eif4a1 G A 11: 69,667,464 probably benign Het
Eps15 T C 4: 109,380,031 probably null Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam135b T A 15: 71,490,827 Q235L probably damaging Het
Fgfr3 T C 5: 33,723,332 probably benign Het
Gabra4 C T 5: 71,633,545 probably null Het
Gins1 A G 2: 150,925,901 Y117C probably damaging Het
Gm12253 T A 11: 58,434,861 S53T probably benign Het
Gm884 CTTTT CTTTTT 11: 103,617,501 probably null Het
Gne C A 4: 44,059,947 A149S possibly damaging Het
Gpc2 A T 5: 138,278,290 C191* probably null Het
Has2 G T 15: 56,681,948 A86E probably damaging Het
Ift80 A T 3: 68,963,649 S205T probably damaging Het
Irx5 G T 8: 92,358,397 A72S probably damaging Het
Kcnmb4 A T 10: 116,473,505 V6E probably benign Het
Kcnt1 A T 2: 25,878,032 Q51L probably benign Het
Klk1b11 A G 7: 43,995,954 probably null Het
Kmt2d T G 15: 98,863,670 M600L unknown Het
Lmtk2 T A 5: 144,147,664 S172R probably damaging Het
Lrrc46 G A 11: 97,034,670 probably benign Het
Mab21l2 C T 3: 86,547,190 V168M probably damaging Het
Magea3 C A X: 154,948,853 C218F probably benign Het
Magea3 A C X: 154,948,854 C218G possibly damaging Het
Man1a2 T C 3: 100,656,042 K96E probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myf6 GGGGGCAG GG 10: 107,494,432 probably benign Het
Nav1 G A 1: 135,607,437 probably benign Het
Nav3 T C 10: 109,852,986 K477E probably damaging Het
Nup98 T A 7: 102,145,714 H862L probably damaging Het
Pcnx2 G T 8: 125,768,298 S1608* probably null Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Ren1 A G 1: 133,359,041 I303V probably benign Het
Retreg3 T A 11: 101,103,887 probably null Het
Rnf6 C A 5: 146,211,279 V310F probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scrn2 C T 11: 97,032,238 A169V probably null Het
Slc4a10 T C 2: 62,243,385 S264P probably benign Het
Tex26 A T 5: 149,460,923 Q102L probably benign Het
Tex38 A G 4: 115,780,223 S128P probably benign Het
Trmt1l A G 1: 151,435,875 probably benign Het
Tyr G T 7: 87,429,076 H525Q probably benign Het
Veph1 T C 3: 66,159,316 N417S probably benign Het
Zfp597 A T 16: 3,865,900 S331T probably damaging Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 intron probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7690:Myom2 UTSW 8 15111717 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTTGAGGTTCACACGGAGGG -3'
(R):5'- AATTCTGACTCACGAGCTCTCC -3'

Sequencing Primer
(F):5'- GAACAAGTGACTAACGCC -3'
(R):5'- GGTGAGCTTTAAGACCCTCATCTAG -3'
Posted On2015-07-06