Incidental Mutation 'R0010:Shprh'
ID 32492
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission 038305-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0010 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 10
Chromosomal Location 11025171-11093339 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11027675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 94 (T94I)
Ref Sequence ENSEMBL: ENSMUSP00000125457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
AlphaFold Q7TPQ3
Predicted Effect probably benign
Transcript: ENSMUST00000044053
AA Change: T94I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: T94I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054814
AA Change: T94I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: T94I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159541
AA Change: T94I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: T94I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159810
AA Change: T94I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: T94I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161858
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,410,607 (GRCm39) probably benign Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Aoc1l3 A T 6: 48,965,840 (GRCm39) H616L probably damaging Het
Bbs7 T C 3: 36,661,866 (GRCm39) probably null Het
Cacna1h T C 17: 25,599,818 (GRCm39) K1566E probably damaging Het
Ccdc73 C T 2: 104,811,332 (GRCm39) probably benign Het
Cd74 A T 18: 60,942,143 (GRCm39) H124L probably benign Het
Cd74 A T 18: 60,936,968 (GRCm39) probably benign Het
Cdk5rap2 T C 4: 70,161,696 (GRCm39) E270G probably benign Het
Ces2a G A 8: 105,468,028 (GRCm39) D520N probably benign Het
Cldnd1 T A 16: 58,551,622 (GRCm39) probably benign Het
Cox17 T A 16: 38,167,532 (GRCm39) C24S possibly damaging Het
Cyp2b9 T A 7: 25,886,178 (GRCm39) probably benign Het
Dennd4a T C 9: 64,803,997 (GRCm39) L1112P probably benign Het
Dennd4c T C 4: 86,699,814 (GRCm39) S222P probably damaging Het
Dhx37 T A 5: 125,508,680 (GRCm39) Q85L probably benign Het
Egfem1 G T 3: 29,637,068 (GRCm39) C192F probably damaging Het
Eif3f A T 7: 108,540,212 (GRCm39) N336Y possibly damaging Het
Evc2 T A 5: 37,574,793 (GRCm39) L1016Q probably damaging Het
Fam114a2 G T 11: 57,404,982 (GRCm39) T40N probably damaging Het
Fam135b T C 15: 71,493,881 (GRCm39) K16R probably damaging Het
Fcho1 A G 8: 72,162,643 (GRCm39) Y725H probably damaging Het
Frem1 T C 4: 82,918,335 (GRCm39) I536V probably benign Het
Galnt2l G A 8: 122,997,337 (GRCm39) probably benign Het
Ginm1 T C 10: 7,651,138 (GRCm39) probably benign Het
Glrb A T 3: 80,767,622 (GRCm39) probably benign Het
Glt6d1 C A 2: 25,684,739 (GRCm39) probably null Het
Gm10320 T C 13: 98,626,054 (GRCm39) Y110C probably damaging Het
Gm3985 A T 8: 33,432,484 (GRCm39) noncoding transcript Het
Gm5422 A G 10: 31,125,750 (GRCm39) noncoding transcript Het
Igkv6-29 A T 6: 70,115,754 (GRCm39) probably benign Het
Inpp5d G A 1: 87,625,268 (GRCm39) probably null Het
Itpr3 T G 17: 27,339,951 (GRCm39) V2610G probably damaging Het
Kmt5c T A 7: 4,749,207 (GRCm39) M88K probably benign Het
Lrp12 C T 15: 39,741,672 (GRCm39) A367T probably damaging Het
Ltbp1 A G 17: 75,670,386 (GRCm39) T1476A probably damaging Het
Mcoln2 C T 3: 145,889,316 (GRCm39) T374M probably damaging Het
Milr1 T G 11: 106,657,829 (GRCm39) *209G probably null Het
Mitf A G 6: 97,784,242 (GRCm39) K33R probably benign Het
Mon2 A C 10: 122,868,599 (GRCm39) S485A probably damaging Het
Mpdu1 C T 11: 69,549,667 (GRCm39) G47R probably damaging Het
Ms4a4d A G 19: 11,532,190 (GRCm39) N112S probably damaging Het
Mybpc3 G A 2: 90,965,178 (GRCm39) W1082* probably null Het
Myl3 A C 9: 110,596,997 (GRCm39) D119A probably damaging Het
Naa15 A T 3: 51,343,634 (GRCm39) probably null Het
Nav3 A G 10: 109,659,087 (GRCm39) probably benign Het
Nek7 T A 1: 138,471,942 (GRCm39) Q66L possibly damaging Het
Nktr G A 9: 121,570,232 (GRCm39) probably benign Het
Nlgn1 G T 3: 25,490,006 (GRCm39) probably benign Het
Npr1 T C 3: 90,362,139 (GRCm39) E1002G probably damaging Het
Nup133 A T 8: 124,631,318 (GRCm39) I1072N probably damaging Het
Oc90 C T 15: 65,748,397 (GRCm39) C371Y probably damaging Het
Or5ak24 A T 2: 85,260,239 (GRCm39) D311E probably benign Het
Or7g20 A T 9: 18,946,618 (GRCm39) L66F probably damaging Het
Or8b42 A T 9: 38,342,216 (GRCm39) I213F possibly damaging Het
Pradc1 A T 6: 85,424,213 (GRCm39) N44K probably damaging Het
Pradc1 T C 6: 85,424,602 (GRCm39) D116G probably damaging Het
Ptprk G A 10: 28,461,965 (GRCm39) C91Y probably damaging Het
Pus7 T C 5: 23,952,843 (GRCm39) I491V probably benign Het
Rock1 T A 18: 10,084,380 (GRCm39) D951V probably damaging Het
Scgb2b26 T A 7: 33,643,774 (GRCm39) E55D probably damaging Het
Scn8a T C 15: 100,911,454 (GRCm39) V958A probably damaging Het
Sec14l1 T C 11: 117,034,596 (GRCm39) probably benign Het
Sec24c A G 14: 20,739,329 (GRCm39) probably benign Het
Sema6b C T 17: 56,431,105 (GRCm39) E853K probably benign Het
Sgk1 G A 10: 21,873,337 (GRCm39) probably null Het
Slc16a3 T C 11: 120,847,531 (GRCm39) S240P probably benign Het
Slc5a8 T C 10: 88,722,452 (GRCm39) V95A probably benign Het
Smg1 A T 7: 117,771,082 (GRCm39) probably benign Het
Spta1 G A 1: 174,045,509 (GRCm39) V1556I probably benign Het
Trappc14 T C 5: 138,258,555 (GRCm39) probably null Het
Trappc4 G A 9: 44,316,528 (GRCm39) probably benign Het
Tubgcp6 A G 15: 88,987,386 (GRCm39) S1188P probably benign Het
Txlna T G 4: 129,522,879 (GRCm39) D487A probably benign Het
Ube2d2b T C 5: 107,978,502 (GRCm39) F51S possibly damaging Het
Vmn2r6 G A 3: 64,466,966 (GRCm39) Q178* probably null Het
Wdfy3 T C 5: 101,996,215 (GRCm39) T3234A probably damaging Het
Ylpm1 C A 12: 85,075,800 (GRCm39) Q384K probably damaging Het
Zbtb41 T G 1: 139,351,268 (GRCm39) V127G probably damaging Het
Zfp605 T A 5: 110,275,400 (GRCm39) C173S probably benign Het
Zfp608 A T 18: 55,028,286 (GRCm39) probably benign Het
Zhx2 T C 15: 57,684,670 (GRCm39) V13A possibly damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11,063,902 (GRCm39) missense probably damaging 1.00
IGL00583:Shprh APN 10 11,063,764 (GRCm39) missense probably benign 0.37
IGL00684:Shprh APN 10 11,038,781 (GRCm39) missense probably benign 0.11
IGL01295:Shprh APN 10 11,059,612 (GRCm39) missense probably damaging 0.96
IGL01387:Shprh APN 10 11,045,998 (GRCm39) missense probably damaging 1.00
IGL01635:Shprh APN 10 11,045,763 (GRCm39) nonsense probably null
IGL01833:Shprh APN 10 11,066,806 (GRCm39) missense probably damaging 1.00
IGL02013:Shprh APN 10 11,057,246 (GRCm39) splice site probably benign
IGL02502:Shprh APN 10 11,070,101 (GRCm39) missense possibly damaging 0.66
IGL02819:Shprh APN 10 11,030,509 (GRCm39) missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11,068,238 (GRCm39) frame shift probably null
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0255:Shprh UTSW 10 11,062,135 (GRCm39) missense possibly damaging 0.92
R0325:Shprh UTSW 10 11,045,853 (GRCm39) missense probably benign 0.00
R0331:Shprh UTSW 10 11,069,914 (GRCm39) splice site probably benign
R0494:Shprh UTSW 10 11,032,935 (GRCm39) missense probably damaging 1.00
R0532:Shprh UTSW 10 11,038,556 (GRCm39) missense possibly damaging 0.90
R0546:Shprh UTSW 10 11,059,631 (GRCm39) splice site probably benign
R0574:Shprh UTSW 10 11,038,821 (GRCm39) unclassified probably benign
R0605:Shprh UTSW 10 11,082,856 (GRCm39) missense probably damaging 1.00
R0662:Shprh UTSW 10 11,062,591 (GRCm39) missense probably damaging 1.00
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1263:Shprh UTSW 10 11,035,274 (GRCm39) missense probably damaging 1.00
R1588:Shprh UTSW 10 11,040,488 (GRCm39) missense probably damaging 1.00
R1638:Shprh UTSW 10 11,032,822 (GRCm39) missense probably benign
R1830:Shprh UTSW 10 11,062,655 (GRCm39) splice site probably null
R1898:Shprh UTSW 10 11,062,613 (GRCm39) missense probably damaging 1.00
R1903:Shprh UTSW 10 11,059,541 (GRCm39) nonsense probably null
R2060:Shprh UTSW 10 11,027,864 (GRCm39) missense probably benign 0.03
R2225:Shprh UTSW 10 11,037,979 (GRCm39) unclassified probably benign
R2363:Shprh UTSW 10 11,047,697 (GRCm39) missense probably damaging 1.00
R2509:Shprh UTSW 10 11,042,468 (GRCm39) missense probably damaging 1.00
R2891:Shprh UTSW 10 11,040,100 (GRCm39) missense probably damaging 1.00
R3077:Shprh UTSW 10 11,046,157 (GRCm39) missense probably damaging 1.00
R3150:Shprh UTSW 10 11,045,774 (GRCm39) missense probably damaging 0.97
R3796:Shprh UTSW 10 11,054,501 (GRCm39) missense possibly damaging 0.89
R4196:Shprh UTSW 10 11,083,604 (GRCm39) utr 3 prime probably benign
R4423:Shprh UTSW 10 11,062,262 (GRCm39) missense possibly damaging 0.82
R4488:Shprh UTSW 10 11,036,215 (GRCm39) missense probably benign 0.17
R4748:Shprh UTSW 10 11,046,220 (GRCm39) missense probably damaging 1.00
R4768:Shprh UTSW 10 11,057,284 (GRCm39) missense probably damaging 0.96
R4867:Shprh UTSW 10 11,040,301 (GRCm39) missense probably benign 0.00
R4937:Shprh UTSW 10 11,032,863 (GRCm39) missense probably benign
R5140:Shprh UTSW 10 11,030,449 (GRCm39) missense probably benign 0.03
R5318:Shprh UTSW 10 11,042,301 (GRCm39) missense probably benign 0.04
R5323:Shprh UTSW 10 11,046,041 (GRCm39) splice site probably null
R5450:Shprh UTSW 10 11,088,074 (GRCm39) missense possibly damaging 0.70
R5872:Shprh UTSW 10 11,063,817 (GRCm39) missense probably damaging 1.00
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6392:Shprh UTSW 10 11,054,485 (GRCm39) nonsense probably null
R6416:Shprh UTSW 10 11,043,617 (GRCm39) missense probably damaging 1.00
R6470:Shprh UTSW 10 11,047,681 (GRCm39) missense probably damaging 0.98
R6513:Shprh UTSW 10 11,062,637 (GRCm39) missense probably damaging 1.00
R6530:Shprh UTSW 10 11,070,011 (GRCm39) missense probably benign 0.02
R6678:Shprh UTSW 10 11,042,289 (GRCm39) missense probably benign 0.16
R6757:Shprh UTSW 10 11,057,252 (GRCm39) splice site probably null
R6971:Shprh UTSW 10 11,042,437 (GRCm39) missense probably damaging 1.00
R7158:Shprh UTSW 10 11,042,474 (GRCm39) missense probably damaging 0.98
R7582:Shprh UTSW 10 11,040,449 (GRCm39) missense probably benign
R7757:Shprh UTSW 10 11,037,924 (GRCm39) missense probably benign 0.30
R7812:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign
R7998:Shprh UTSW 10 11,061,085 (GRCm39) missense probably damaging 1.00
R8061:Shprh UTSW 10 11,088,077 (GRCm39) missense possibly damaging 0.71
R8082:Shprh UTSW 10 11,027,555 (GRCm39) missense probably benign 0.22
R8116:Shprh UTSW 10 11,089,205 (GRCm39) missense probably damaging 0.99
R8390:Shprh UTSW 10 11,063,727 (GRCm39) missense possibly damaging 0.92
R8445:Shprh UTSW 10 11,057,313 (GRCm39) missense possibly damaging 0.92
R8530:Shprh UTSW 10 11,027,678 (GRCm39) missense probably benign 0.37
R8759:Shprh UTSW 10 11,032,908 (GRCm39) missense possibly damaging 0.92
R8937:Shprh UTSW 10 11,061,181 (GRCm39) missense possibly damaging 0.60
R8995:Shprh UTSW 10 11,040,574 (GRCm39) nonsense probably null
R9053:Shprh UTSW 10 11,030,446 (GRCm39) missense probably benign 0.04
R9131:Shprh UTSW 10 11,038,589 (GRCm39) missense possibly damaging 0.58
R9176:Shprh UTSW 10 11,036,320 (GRCm39) missense probably benign 0.02
R9391:Shprh UTSW 10 11,038,633 (GRCm39) missense probably benign 0.05
R9423:Shprh UTSW 10 11,081,007 (GRCm39) missense probably damaging 1.00
R9563:Shprh UTSW 10 11,042,235 (GRCm39) nonsense probably null
R9668:Shprh UTSW 10 11,082,076 (GRCm39) missense probably damaging 0.97
R9709:Shprh UTSW 10 11,038,574 (GRCm39) missense possibly damaging 0.91
R9718:Shprh UTSW 10 11,089,248 (GRCm39) missense probably damaging 1.00
R9750:Shprh UTSW 10 11,040,204 (GRCm39) missense probably damaging 0.98
RF012:Shprh UTSW 10 11,040,585 (GRCm39) missense probably benign 0.02
V8831:Shprh UTSW 10 11,062,606 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,062,191 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,040,297 (GRCm39) missense probably benign
Z1177:Shprh UTSW 10 11,027,506 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGCAACAGCAGCTTCACTGGAAC -3'
(R):5'- GCTACAAACACCGGCTGATCCTTC -3'

Sequencing Primer
(F):5'- TGAGCCGCTCACCATGAC -3'
(R):5'- GGCTGATCCTTCAAGAACATTTTC -3'
Posted On 2013-05-09