Incidental Mutation 'R4361:Scrn2'
ID324924
Institutional Source Beutler Lab
Gene Symbol Scrn2
Ensembl Gene ENSMUSG00000020877
Gene Namesecernin 2
SynonymsSES2, D11Moh48
MMRRC Submission 041112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4361 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location97029938-97033958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97032238 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 169 (A169V)
Ref Sequence ENSEMBL: ENSMUSP00000116606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021249] [ENSMUST00000021251] [ENSMUST00000153482]
Predicted Effect probably damaging
Transcript: ENSMUST00000021249
AA Change: A169V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021249
Gene: ENSMUSG00000020877
AA Change: A169V

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Peptidase_C69 83 254 2e-10 PFAM
coiled coil region 362 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021251
SMART Domains Protein: ENSMUSP00000021251
Gene: ENSMUSG00000020878

DomainStartEndE-ValueType
SCOP:d1h6ua2 44 150 1e-15 SMART
Blast:LRR 69 91 7e-6 BLAST
low complexity region 179 191 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 265 292 N/A INTRINSIC
low complexity region 297 323 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133054
Predicted Effect probably null
Transcript: ENSMUST00000153482
AA Change: A169V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116606
Gene: ENSMUSG00000020877
AA Change: A169V

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Peptidase_C69 59 181 2.4e-9 PFAM
Meta Mutation Damage Score 0.6921 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,706 T538A probably damaging Het
1700027J19Rik A G 7: 4,151,780 V3A possibly damaging Het
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Aadac T A 3: 60,039,761 S293R probably benign Het
Cc2d1b G A 4: 108,624,750 probably benign Het
Ccdc157 C T 11: 4,146,550 A400T probably damaging Het
Cyp11b1 T A 15: 74,839,016 M232L possibly damaging Het
Dhrs2 G A 14: 55,241,189 D264N probably damaging Het
Dram2 T C 3: 106,566,215 probably benign Het
Dtx4 C A 19: 12,485,296 S373I probably benign Het
Eif4a1 G A 11: 69,667,464 probably benign Het
Eps15 T C 4: 109,380,031 probably null Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam135b T A 15: 71,490,827 Q235L probably damaging Het
Fgfr3 T C 5: 33,723,332 probably benign Het
Gabra4 C T 5: 71,633,545 probably null Het
Gins1 A G 2: 150,925,901 Y117C probably damaging Het
Gm12253 T A 11: 58,434,861 S53T probably benign Het
Gm884 CTTTT CTTTTT 11: 103,617,501 probably null Het
Gne C A 4: 44,059,947 A149S possibly damaging Het
Gpc2 A T 5: 138,278,290 C191* probably null Het
Has2 G T 15: 56,681,948 A86E probably damaging Het
Ift80 A T 3: 68,963,649 S205T probably damaging Het
Irx5 G T 8: 92,358,397 A72S probably damaging Het
Kcnmb4 A T 10: 116,473,505 V6E probably benign Het
Kcnt1 A T 2: 25,878,032 Q51L probably benign Het
Klk1b11 A G 7: 43,995,954 probably null Het
Kmt2d T G 15: 98,863,670 M600L unknown Het
Lmtk2 T A 5: 144,147,664 S172R probably damaging Het
Lrrc46 G A 11: 97,034,670 probably benign Het
Mab21l2 C T 3: 86,547,190 V168M probably damaging Het
Magea3 A C X: 154,948,854 C218G possibly damaging Het
Magea3 C A X: 154,948,853 C218F probably benign Het
Man1a2 T C 3: 100,656,042 K96E probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myf6 GGGGGCAG GG 10: 107,494,432 probably benign Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nav1 G A 1: 135,607,437 probably benign Het
Nav3 T C 10: 109,852,986 K477E probably damaging Het
Nup98 T A 7: 102,145,714 H862L probably damaging Het
Pcnx2 G T 8: 125,768,298 S1608* probably null Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Ren1 A G 1: 133,359,041 I303V probably benign Het
Retreg3 T A 11: 101,103,887 probably null Het
Rnf6 C A 5: 146,211,279 V310F probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a10 T C 2: 62,243,385 S264P probably benign Het
Tex26 A T 5: 149,460,923 Q102L probably benign Het
Tex38 A G 4: 115,780,223 S128P probably benign Het
Trmt1l A G 1: 151,435,875 probably benign Het
Tyr G T 7: 87,429,076 H525Q probably benign Het
Veph1 T C 3: 66,159,316 N417S probably benign Het
Zfp597 A T 16: 3,865,900 S331T probably damaging Het
Other mutations in Scrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Scrn2 APN 11 97030570 missense probably benign 0.03
IGL01580:Scrn2 APN 11 97032130 missense probably benign
R1847:Scrn2 UTSW 11 97032195 missense probably benign 0.22
R2509:Scrn2 UTSW 11 97033166 missense possibly damaging 0.71
R2698:Scrn2 UTSW 11 97032296 unclassified probably benign
R4927:Scrn2 UTSW 11 97033500 critical splice donor site probably null
R5040:Scrn2 UTSW 11 97030883 missense probably damaging 1.00
R5367:Scrn2 UTSW 11 97033127 missense possibly damaging 0.95
R5534:Scrn2 UTSW 11 97030925 missense probably benign 0.00
R6145:Scrn2 UTSW 11 97032853 missense probably benign 0.35
R7029:Scrn2 UTSW 11 97030436 unclassified probably benign
R7082:Scrn2 UTSW 11 97033082 missense possibly damaging 0.68
R7165:Scrn2 UTSW 11 97033808 missense probably benign
R7468:Scrn2 UTSW 11 97033166 missense possibly damaging 0.95
R7568:Scrn2 UTSW 11 97030886 missense probably damaging 1.00
R7632:Scrn2 UTSW 11 97033142 missense possibly damaging 0.51
R7950:Scrn2 UTSW 11 97030929 missense probably damaging 1.00
R8239:Scrn2 UTSW 11 97032220 missense probably damaging 1.00
R8398:Scrn2 UTSW 11 97030904 missense probably benign 0.07
R8408:Scrn2 UTSW 11 97031043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGACCGCTTCTGTACTC -3'
(R):5'- GTTCATTTCTAGTCTCCCAGGG -3'

Sequencing Primer
(F):5'- GGACCGCTTCTGTACTCTGATTTTC -3'
(R):5'- TAGTCTCCCAGGGTGTCCC -3'
Posted On2015-07-06