Incidental Mutation 'R4361:Dhrs2'
ID324928
Institutional Source Beutler Lab
Gene Symbol Dhrs2
Ensembl Gene ENSMUSG00000022209
Gene Namedehydrogenase/reductase member 2
Synonyms5430405K24Rik, SDR family
MMRRC Submission 041112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4361 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55222007-55241435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55241189 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 264 (D264N)
Ref Sequence ENSEMBL: ENSMUSP00000129115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022820] [ENSMUST00000165432]
Predicted Effect probably damaging
Transcript: ENSMUST00000022820
AA Change: D264N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022820
Gene: ENSMUSG00000022209
AA Change: D264N

DomainStartEndE-ValueType
Pfam:adh_short 38 206 2.2e-31 PFAM
Pfam:KR 39 213 1.4e-11 PFAM
Pfam:adh_short_C2 43 279 2.8e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165432
AA Change: D264N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129115
Gene: ENSMUSG00000022209
AA Change: D264N

DomainStartEndE-ValueType
Pfam:adh_short 38 233 6.3e-52 PFAM
Pfam:KR 39 213 9.1e-12 PFAM
Pfam:adh_short_C2 43 279 1.8e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228056
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,706 T538A probably damaging Het
1700027J19Rik A G 7: 4,151,780 V3A possibly damaging Het
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Aadac T A 3: 60,039,761 S293R probably benign Het
Cc2d1b G A 4: 108,624,750 probably benign Het
Ccdc157 C T 11: 4,146,550 A400T probably damaging Het
Cyp11b1 T A 15: 74,839,016 M232L possibly damaging Het
Dram2 T C 3: 106,566,215 probably benign Het
Dtx4 C A 19: 12,485,296 S373I probably benign Het
Eif4a1 G A 11: 69,667,464 probably benign Het
Eps15 T C 4: 109,380,031 probably null Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam135b T A 15: 71,490,827 Q235L probably damaging Het
Fgfr3 T C 5: 33,723,332 probably benign Het
Gabra4 C T 5: 71,633,545 probably null Het
Gins1 A G 2: 150,925,901 Y117C probably damaging Het
Gm12253 T A 11: 58,434,861 S53T probably benign Het
Gm884 CTTTT CTTTTT 11: 103,617,501 probably null Het
Gne C A 4: 44,059,947 A149S possibly damaging Het
Gpc2 A T 5: 138,278,290 C191* probably null Het
Has2 G T 15: 56,681,948 A86E probably damaging Het
Ift80 A T 3: 68,963,649 S205T probably damaging Het
Irx5 G T 8: 92,358,397 A72S probably damaging Het
Kcnmb4 A T 10: 116,473,505 V6E probably benign Het
Kcnt1 A T 2: 25,878,032 Q51L probably benign Het
Klk1b11 A G 7: 43,995,954 probably null Het
Kmt2d T G 15: 98,863,670 M600L unknown Het
Lmtk2 T A 5: 144,147,664 S172R probably damaging Het
Lrrc46 G A 11: 97,034,670 probably benign Het
Mab21l2 C T 3: 86,547,190 V168M probably damaging Het
Magea3 C A X: 154,948,853 C218F probably benign Het
Magea3 A C X: 154,948,854 C218G possibly damaging Het
Man1a2 T C 3: 100,656,042 K96E probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myf6 GGGGGCAG GG 10: 107,494,432 probably benign Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nav1 G A 1: 135,607,437 probably benign Het
Nav3 T C 10: 109,852,986 K477E probably damaging Het
Nup98 T A 7: 102,145,714 H862L probably damaging Het
Pcnx2 G T 8: 125,768,298 S1608* probably null Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Ren1 A G 1: 133,359,041 I303V probably benign Het
Retreg3 T A 11: 101,103,887 probably null Het
Rnf6 C A 5: 146,211,279 V310F probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scrn2 C T 11: 97,032,238 A169V probably null Het
Slc4a10 T C 2: 62,243,385 S264P probably benign Het
Tex26 A T 5: 149,460,923 Q102L probably benign Het
Tex38 A G 4: 115,780,223 S128P probably benign Het
Trmt1l A G 1: 151,435,875 probably benign Het
Tyr G T 7: 87,429,076 H525Q probably benign Het
Veph1 T C 3: 66,159,316 N417S probably benign Het
Zfp597 A T 16: 3,865,900 S331T probably damaging Het
Other mutations in Dhrs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Dhrs2 APN 14 55234663 missense probably benign 0.00
IGL02510:Dhrs2 APN 14 55236075 missense probably damaging 1.00
IGL02604:Dhrs2 APN 14 55237321 missense possibly damaging 0.88
IGL02746:Dhrs2 APN 14 55241171 missense probably damaging 1.00
IGL03060:Dhrs2 APN 14 55237318 missense probably benign 0.06
R0179:Dhrs2 UTSW 14 55240476 missense probably damaging 1.00
R0358:Dhrs2 UTSW 14 55236117 missense probably damaging 0.99
R0755:Dhrs2 UTSW 14 55234790 missense probably damaging 1.00
R1848:Dhrs2 UTSW 14 55240841 missense probably benign
R1977:Dhrs2 UTSW 14 55234655 start codon destroyed probably null 0.11
R3084:Dhrs2 UTSW 14 55239844 missense probably benign 0.00
R3086:Dhrs2 UTSW 14 55239844 missense probably benign 0.00
R3805:Dhrs2 UTSW 14 55234748 missense probably benign 0.03
R3806:Dhrs2 UTSW 14 55234748 missense probably benign 0.03
R4754:Dhrs2 UTSW 14 55238748 missense probably damaging 0.97
R4989:Dhrs2 UTSW 14 55237265 missense probably damaging 1.00
R5307:Dhrs2 UTSW 14 55236144 missense possibly damaging 0.71
R7561:Dhrs2 UTSW 14 55237241 missense probably benign
R8245:Dhrs2 UTSW 14 55241180 missense possibly damaging 0.94
R8296:Dhrs2 UTSW 14 55240471 missense probably damaging 1.00
R8324:Dhrs2 UTSW 14 55238764 missense probably damaging 1.00
R8782:Dhrs2 UTSW 14 55236081 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCCCTTCTGGAATCCTGAG -3'
(R):5'- AGTATCCCTATATGACCTGGATCCC -3'

Sequencing Primer
(F):5'- CCCTTCTGGAATCCTGAGTTGGG -3'
(R):5'- TGGATCCCAAGCACATCTTAAGG -3'
Posted On2015-07-06