Incidental Mutation 'R4361:Has2'
ID 324930
Institutional Source Beutler Lab
Gene Symbol Has2
Ensembl Gene ENSMUSG00000022367
Gene Name hyaluronan synthase 2
Synonyms
MMRRC Submission 041112-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4361 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 56529023-56557935 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 56545344 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 86 (A86E)
Ref Sequence ENSEMBL: ENSMUSP00000062212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050544]
AlphaFold P70312
Predicted Effect probably damaging
Transcript: ENSMUST00000050544
AA Change: A86E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062212
Gene: ENSMUSG00000022367
AA Change: A86E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Pfam:Glycos_transf_2 86 156 1.7e-7 PFAM
Pfam:Glyco_tranf_2_3 159 357 1.2e-17 PFAM
Pfam:Chitin_synth_2 193 464 1.9e-17 PFAM
Pfam:Glyco_trans_2_3 207 534 1.3e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation die during midgestation with severe defects in yolk sac and systemic vasculature, including pericardial edema, compaction of the extracellular space, and absence of endocardial cushions and trabeculae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,139,688 (GRCm39) T538A probably damaging Het
4930578I07Rik T C 14: 67,175,850 (GRCm39) noncoding transcript Het
Aadac T A 3: 59,947,182 (GRCm39) S293R probably benign Het
Cc2d1b G A 4: 108,481,947 (GRCm39) probably benign Het
Ccdc157 C T 11: 4,096,550 (GRCm39) A400T probably damaging Het
Cdc42ep5 A G 7: 4,154,779 (GRCm39) V3A possibly damaging Het
Cyp11b1 T A 15: 74,710,865 (GRCm39) M232L possibly damaging Het
Dhrs2 G A 14: 55,478,646 (GRCm39) D264N probably damaging Het
Dram2 T C 3: 106,473,531 (GRCm39) probably benign Het
Dtx4 C A 19: 12,462,660 (GRCm39) S373I probably benign Het
Eif4a1 G A 11: 69,558,290 (GRCm39) probably benign Het
Eps15 T C 4: 109,237,228 (GRCm39) probably null Het
Fam135b T A 15: 71,362,676 (GRCm39) Q235L probably damaging Het
Fgfr3 T C 5: 33,880,676 (GRCm39) probably benign Het
Gabra4 C T 5: 71,790,888 (GRCm39) probably null Het
Gins1 A G 2: 150,767,821 (GRCm39) Y117C probably damaging Het
Gm12253 T A 11: 58,325,687 (GRCm39) S53T probably benign Het
Gne C A 4: 44,059,947 (GRCm39) A149S possibly damaging Het
Gpc2 A T 5: 138,276,552 (GRCm39) C191* probably null Het
Ift80 A T 3: 68,870,982 (GRCm39) S205T probably damaging Het
Irx5 G T 8: 93,085,025 (GRCm39) A72S probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kcnt1 A T 2: 25,768,044 (GRCm39) Q51L probably benign Het
Klk1b11 A G 7: 43,645,378 (GRCm39) probably null Het
Kmt2d T G 15: 98,761,551 (GRCm39) M600L unknown Het
Lmtk2 T A 5: 144,084,482 (GRCm39) S172R probably damaging Het
Lrrc37 CTTTT CTTTTT 11: 103,508,327 (GRCm39) probably null Het
Lrrc46 G A 11: 96,925,496 (GRCm39) probably benign Het
Mab21l2 C T 3: 86,454,497 (GRCm39) V168M probably damaging Het
Magea3 A C X: 153,731,850 (GRCm39) C218G possibly damaging Het
Magea3 C A X: 153,731,849 (GRCm39) C218F probably benign Het
Man1a2 T C 3: 100,563,358 (GRCm39) K96E probably benign Het
Mroh2a A T 1: 88,182,687 (GRCm39) N1205I possibly damaging Het
Myf6 GGGGGCAG GG 10: 107,330,293 (GRCm39) probably benign Het
Myom2 G A 8: 15,162,018 (GRCm39) V984I possibly damaging Het
Nav1 G A 1: 135,535,175 (GRCm39) probably benign Het
Nav3 T C 10: 109,688,847 (GRCm39) K477E probably damaging Het
Nup98 T A 7: 101,794,921 (GRCm39) H862L probably damaging Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Pcnx2 G T 8: 126,495,037 (GRCm39) S1608* probably null Het
Pramel16 A G 4: 143,677,433 (GRCm39) F49L possibly damaging Het
Ren1 A G 1: 133,286,779 (GRCm39) I303V probably benign Het
Retreg3 T A 11: 100,994,713 (GRCm39) probably null Het
Rnf6 C A 5: 146,148,089 (GRCm39) V310F probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scrn2 C T 11: 96,923,064 (GRCm39) A169V probably null Het
Slc4a10 T C 2: 62,073,729 (GRCm39) S264P probably benign Het
Tex26 A T 5: 149,384,388 (GRCm39) Q102L probably benign Het
Tex38 A G 4: 115,637,420 (GRCm39) S128P probably benign Het
Trmt1l A G 1: 151,311,626 (GRCm39) probably benign Het
Tyr G T 7: 87,078,284 (GRCm39) H525Q probably benign Het
Veph1 T C 3: 66,066,737 (GRCm39) N417S probably benign Het
Zfp597 A T 16: 3,683,764 (GRCm39) S331T probably damaging Het
Other mutations in Has2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Has2 APN 15 56,545,072 (GRCm39) missense possibly damaging 0.51
IGL02027:Has2 APN 15 56,531,567 (GRCm39) missense probably damaging 1.00
IGL02178:Has2 APN 15 56,545,456 (GRCm39) missense probably damaging 1.00
IGL02493:Has2 APN 15 56,531,320 (GRCm39) missense probably damaging 1.00
IGL02533:Has2 APN 15 56,545,091 (GRCm39) missense probably benign 0.00
IGL03142:Has2 APN 15 56,545,491 (GRCm39) missense possibly damaging 0.92
IGL03240:Has2 APN 15 56,531,656 (GRCm39) missense probably damaging 1.00
R0189:Has2 UTSW 15 56,531,831 (GRCm39) missense probably damaging 1.00
R0362:Has2 UTSW 15 56,545,057 (GRCm39) missense probably damaging 1.00
R1377:Has2 UTSW 15 56,545,202 (GRCm39) missense probably damaging 1.00
R1762:Has2 UTSW 15 56,545,006 (GRCm39) missense probably benign 0.13
R1845:Has2 UTSW 15 56,531,974 (GRCm39) missense probably damaging 1.00
R2012:Has2 UTSW 15 56,531,264 (GRCm39) missense probably damaging 1.00
R2190:Has2 UTSW 15 56,531,183 (GRCm39) missense probably benign 0.00
R2656:Has2 UTSW 15 56,545,224 (GRCm39) missense possibly damaging 0.90
R2966:Has2 UTSW 15 56,545,533 (GRCm39) missense probably damaging 1.00
R5698:Has2 UTSW 15 56,531,312 (GRCm39) missense probably damaging 1.00
R5826:Has2 UTSW 15 56,531,498 (GRCm39) missense probably damaging 1.00
R5883:Has2 UTSW 15 56,531,459 (GRCm39) missense possibly damaging 0.49
R5942:Has2 UTSW 15 56,531,192 (GRCm39) nonsense probably null
R6433:Has2 UTSW 15 56,531,194 (GRCm39) missense possibly damaging 0.79
R6560:Has2 UTSW 15 56,531,660 (GRCm39) missense probably damaging 1.00
R6603:Has2 UTSW 15 56,531,968 (GRCm39) missense probably damaging 1.00
R7094:Has2 UTSW 15 56,545,017 (GRCm39) missense probably damaging 1.00
R7597:Has2 UTSW 15 56,531,817 (GRCm39) missense probably damaging 1.00
R7738:Has2 UTSW 15 56,531,108 (GRCm39) missense possibly damaging 0.89
R8060:Has2 UTSW 15 56,533,341 (GRCm39) missense probably benign 0.00
R8145:Has2 UTSW 15 56,545,175 (GRCm39) missense probably benign
R8915:Has2 UTSW 15 56,531,885 (GRCm39) missense probably damaging 1.00
R8964:Has2 UTSW 15 56,531,061 (GRCm39) missense probably damaging 0.96
R9144:Has2 UTSW 15 56,545,588 (GRCm39) missense probably benign 0.03
R9411:Has2 UTSW 15 56,531,306 (GRCm39) missense possibly damaging 0.62
R9416:Has2 UTSW 15 56,531,684 (GRCm39) missense probably damaging 1.00
R9551:Has2 UTSW 15 56,531,090 (GRCm39) missense probably benign 0.00
R9552:Has2 UTSW 15 56,531,090 (GRCm39) missense probably benign 0.00
Z1177:Has2 UTSW 15 56,544,979 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACCAGGTCCCTTTTCATGAAAG -3'
(R):5'- ATCACAGCTGCTTATATTGTTGGC -3'

Sequencing Primer
(F):5'- TCTTCCAGATGTACGTGGCCG -3'
(R):5'- GTTGGCTACCAGTTTATCCAAACAG -3'
Posted On 2015-07-06