Incidental Mutation 'R4361:Dtx4'
ID 324934
Institutional Source Beutler Lab
Gene Symbol Dtx4
Ensembl Gene ENSMUSG00000039982
Gene Name deltex 4, E3 ubiquitin ligase
Synonyms RNF155
MMRRC Submission 041112-MU
Accession Numbers

Genbank: NM_001047855

Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R4361 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12466341-12501996 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 12485296 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 373 (S373I)
Ref Sequence ENSEMBL: ENSMUSP00000040229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521]
AlphaFold Q6PDK8
Predicted Effect probably benign
Transcript: ENSMUST00000045521
AA Change: S373I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982
AA Change: S373I

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (61/61)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,706 T538A probably damaging Het
1700027J19Rik A G 7: 4,151,780 V3A possibly damaging Het
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Aadac T A 3: 60,039,761 S293R probably benign Het
Cc2d1b G A 4: 108,624,750 probably benign Het
Ccdc157 C T 11: 4,146,550 A400T probably damaging Het
Cyp11b1 T A 15: 74,839,016 M232L possibly damaging Het
Dhrs2 G A 14: 55,241,189 D264N probably damaging Het
Dram2 T C 3: 106,566,215 probably benign Het
Eif4a1 G A 11: 69,667,464 probably benign Het
Eps15 T C 4: 109,380,031 probably null Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam135b T A 15: 71,490,827 Q235L probably damaging Het
Fgfr3 T C 5: 33,723,332 probably benign Het
Gabra4 C T 5: 71,633,545 probably null Het
Gins1 A G 2: 150,925,901 Y117C probably damaging Het
Gm12253 T A 11: 58,434,861 S53T probably benign Het
Gm884 CTTTT CTTTTT 11: 103,617,501 probably null Het
Gne C A 4: 44,059,947 A149S possibly damaging Het
Gpc2 A T 5: 138,278,290 C191* probably null Het
Has2 G T 15: 56,681,948 A86E probably damaging Het
Ift80 A T 3: 68,963,649 S205T probably damaging Het
Irx5 G T 8: 92,358,397 A72S probably damaging Het
Kcnmb4 A T 10: 116,473,505 V6E probably benign Het
Kcnt1 A T 2: 25,878,032 Q51L probably benign Het
Klk1b11 A G 7: 43,995,954 probably null Het
Kmt2d T G 15: 98,863,670 M600L unknown Het
Lmtk2 T A 5: 144,147,664 S172R probably damaging Het
Lrrc46 G A 11: 97,034,670 probably benign Het
Mab21l2 C T 3: 86,547,190 V168M probably damaging Het
Magea3 C A X: 154,948,853 C218F probably benign Het
Magea3 A C X: 154,948,854 C218G possibly damaging Het
Man1a2 T C 3: 100,656,042 K96E probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myf6 GGGGGCAG GG 10: 107,494,432 probably benign Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nav1 G A 1: 135,607,437 probably benign Het
Nav3 T C 10: 109,852,986 K477E probably damaging Het
Nup98 T A 7: 102,145,714 H862L probably damaging Het
Pcnx2 G T 8: 125,768,298 S1608* probably null Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Ren1 A G 1: 133,359,041 I303V probably benign Het
Retreg3 T A 11: 101,103,887 probably null Het
Rnf6 C A 5: 146,211,279 V310F probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scrn2 C T 11: 97,032,238 A169V probably null Het
Slc4a10 T C 2: 62,243,385 S264P probably benign Het
Tex26 A T 5: 149,460,923 Q102L probably benign Het
Tex38 A G 4: 115,780,223 S128P probably benign Het
Trmt1l A G 1: 151,435,875 probably benign Het
Tyr G T 7: 87,429,076 H525Q probably benign Het
Veph1 T C 3: 66,159,316 N417S probably benign Het
Zfp597 A T 16: 3,865,900 S331T probably damaging Het
Other mutations in Dtx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Dtx4 APN 19 12478215 missense possibly damaging 0.88
IGL02173:Dtx4 APN 19 12473257 nonsense probably null
IGL03127:Dtx4 APN 19 12486500 splice site probably benign
G5030:Dtx4 UTSW 19 12469579 missense probably benign 0.07
R0143:Dtx4 UTSW 19 12486482 missense probably damaging 0.98
R0932:Dtx4 UTSW 19 12492151 missense probably benign
R1066:Dtx4 UTSW 19 12501009 missense probably damaging 0.98
R2155:Dtx4 UTSW 19 12485282 nonsense probably null
R2182:Dtx4 UTSW 19 12483107 missense probably null 0.75
R2362:Dtx4 UTSW 19 12492535 missense probably damaging 1.00
R3880:Dtx4 UTSW 19 12486456 missense probably benign 0.01
R4108:Dtx4 UTSW 19 12501123 missense probably damaging 0.96
R4943:Dtx4 UTSW 19 12501060 missense probably damaging 1.00
R5361:Dtx4 UTSW 19 12485262 critical splice donor site probably null
R5440:Dtx4 UTSW 19 12492317 missense probably damaging 1.00
R5613:Dtx4 UTSW 19 12485403 missense probably damaging 0.97
R5614:Dtx4 UTSW 19 12482183 missense probably damaging 1.00
R5703:Dtx4 UTSW 19 12482210 missense possibly damaging 0.84
R5994:Dtx4 UTSW 19 12501153 missense probably damaging 1.00
R6695:Dtx4 UTSW 19 12473235 nonsense probably null
R7107:Dtx4 UTSW 19 12473260 nonsense probably null
R7208:Dtx4 UTSW 19 12482073 critical splice donor site probably null
R7231:Dtx4 UTSW 19 12469658 nonsense probably null
R7521:Dtx4 UTSW 19 12492497 missense probably benign 0.30
R7609:Dtx4 UTSW 19 12492281 missense probably damaging 1.00
R7721:Dtx4 UTSW 19 12482136 missense probably benign 0.09
R7775:Dtx4 UTSW 19 12492010 missense probably benign 0.02
R8685:Dtx4 UTSW 19 12469631 missense probably benign 0.36
Z1176:Dtx4 UTSW 19 12491909 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGGTAGTTCTTTCTGACCCAG -3'
(R):5'- TTGGGAGCGCATTCTTCAG -3'

Sequencing Primer
(F):5'- TGGACTCATCATAGTCTACTAGCCAG -3'
(R):5'- GCGCATTCTTCAGCCCGTTC -3'
Posted On 2015-07-06