Incidental Mutation 'R4362:Glrx2'
ID324939
Institutional Source Beutler Lab
Gene Symbol Glrx2
Ensembl Gene ENSMUSG00000018196
Gene Nameglutaredoxin 2 (thioltransferase)
SynonymsGrx2, 1700010P22Rik
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4362 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location143716338-143749676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143741680 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 44 (K44R)
Ref Sequence ENSEMBL: ENSMUSP00000141022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050491] [ENSMUST00000111957] [ENSMUST00000129653] [ENSMUST00000145571] [ENSMUST00000145969] [ENSMUST00000185362]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050491
AA Change: K44R

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053443
Gene: ENSMUSG00000018196
AA Change: K44R

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:Glutaredoxin 62 124 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111957
AA Change: K11R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107588
Gene: ENSMUSG00000018196
AA Change: K11R

DomainStartEndE-ValueType
Pfam:Glutaredoxin 29 91 8.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126514
Predicted Effect probably benign
Transcript: ENSMUST00000129653
AA Change: K11R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121010
Gene: ENSMUSG00000018196
AA Change: K11R

DomainStartEndE-ValueType
Pfam:Glutaredoxin 29 91 8.3e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000145571
AA Change: K44R
SMART Domains Protein: ENSMUSP00000115893
Gene: ENSMUSG00000018196
AA Change: K44R

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:Glutaredoxin 62 117 1.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145969
AA Change: K11R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121665
Gene: ENSMUSG00000018196
AA Change: K11R

DomainStartEndE-ValueType
Pfam:Glutaredoxin 29 91 8.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152435
Predicted Effect possibly damaging
Transcript: ENSMUST00000185362
AA Change: K44R

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141022
Gene: ENSMUSG00000018196
AA Change: K44R

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:Glutaredoxin 62 124 1.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190211
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the glutaredoxin family of proteins, which maintain cellular thiol homeostasis. These proteins are thiol-disulfide oxidoreductases that use a glutathione-binding site and one or two active cysteines in their active site. This gene undergoes alternative splicing to produce multiple isoforms, one of which is ubiquitously expressed and localizes to mitochondria, where it functions in mitochondrial redox homeostasis and is important for the protection against and recovery from oxidative stress. Other isoforms, which have more restrictive expression patterns, show cytosolic and nuclear localization, and are thought to function in cellular differentiation and transformation, possibly with a role in tumor progression. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to oxidative stress in primary mouse lens epithelial cells, and an increased level of glutathionylated proteins in mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Glrx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02161:Glrx2 APN 1 143739683 missense possibly damaging 0.66
R1728:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1762:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1783:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1784:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1785:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R2132:Glrx2 UTSW 1 143745104 missense possibly damaging 0.92
R5418:Glrx2 UTSW 1 143739708 missense possibly damaging 0.83
R5496:Glrx2 UTSW 1 143745207 missense probably damaging 0.98
R5952:Glrx2 UTSW 1 143745134 missense probably benign 0.03
R6225:Glrx2 UTSW 1 143745383 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTTAGAGAAGCACGTGGGTC -3'
(R):5'- TGAAATGGTATAGGACTTGTCACAAGG -3'

Sequencing Primer
(F):5'- CTGGTGTTAGCGGACAAGTAC -3'
(R):5'- GGACTTGTCACAAGGATAACTTTG -3'
Posted On2015-07-06