Mutagenetix > Incidental Mutation

Incidental Mutation 'R4362:Glrx2'

324939

Institutional Source

Beutler Lab

Gene Symbol

Glrx2

Ensembl Gene

ENSMUSG00000018196

Gene Name

glutaredoxin 2

Synonyms

Grx2, thioltransferase, 1700010P22Rik

MMRRC Submission

041671-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R4362 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

143614787-143625416 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143617418 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 44 (K44R)

Ref Sequence

ENSEMBL: ENSMUSP00000141022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050491] [ENSMUST00000111957] [ENSMUST00000129653] [ENSMUST00000145571] [ENSMUST00000145969] [ENSMUST00000185362]

AlphaFold

Q923X4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000050491
AA Change: K44R

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000053443
Gene: ENSMUSG00000018196
AA Change: K44R

Domain	Start	End	E-Value	Type
low complexity region	15	40	N/A	INTRINSIC
Pfam:Glutaredoxin	62	124	1.6e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111957
AA Change: K11R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000107588
Gene: ENSMUSG00000018196
AA Change: K11R

Domain	Start	End	E-Value	Type
Pfam:Glutaredoxin	29	91	8.3e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126514

Predicted Effect

probably benign
Transcript: ENSMUST00000129653
AA Change: K11R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000121010
Gene: ENSMUSG00000018196
AA Change: K11R

Domain	Start	End	E-Value	Type
Pfam:Glutaredoxin	29	91	8.3e-22	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000145571
AA Change: K44R

SMART Domains

Protein: ENSMUSP00000115893
Gene: ENSMUSG00000018196
AA Change: K44R

Domain	Start	End	E-Value	Type
low complexity region	15	40	N/A	INTRINSIC
Pfam:Glutaredoxin	62	117	1.8e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145969
AA Change: K11R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000121665
Gene: ENSMUSG00000018196
AA Change: K11R

Domain	Start	End	E-Value	Type
Pfam:Glutaredoxin	29	91	8.3e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148600

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149103

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185362
AA Change: K44R

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141022
Gene: ENSMUSG00000018196
AA Change: K44R

Domain	Start	End	E-Value	Type
low complexity region	15	40	N/A	INTRINSIC
Pfam:Glutaredoxin	62	124	1.6e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185367

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190211

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188783

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152435

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the glutaredoxin family of proteins, which maintain cellular thiol homeostasis. These proteins are thiol-disulfide oxidoreductases that use a glutathione-binding site and one or two active cysteines in their active site. This gene undergoes alternative splicing to produce multiple isoforms, one of which is ubiquitously expressed and localizes to mitochondria, where it functions in mitochondrial redox homeostasis and is important for the protection against and recovery from oxidative stress. Other isoforms, which have more restrictive expression patterns, show cytosolic and nuclear localization, and are thought to function in cellular differentiation and transformation, possibly with a role in tumor progression. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to oxidative stress in primary mouse lens epithelial cells, and an increased level of glutathionylated proteins in mitochondria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	C	T	7: 28,947,687 (GRCm39)		probably benign	Het
Abcc6	A	G	7: 45,648,256 (GRCm39)		probably benign	Het
Adamts13	G	A	2: 26,894,794 (GRCm39)	C1034Y	probably damaging	Het
Atp2b4	G	T	1: 133,667,669 (GRCm39)	P125Q	possibly damaging	Het
Atp8b1	C	T	18: 64,697,608 (GRCm39)	R412H	probably damaging	Het
Bicc1	ATGTG	ATG	10: 70,779,204 (GRCm39)		probably null	Het
Cap1	G	A	4: 122,756,780 (GRCm39)	P302S	probably benign	Het
Chodl	G	T	16: 78,741,546 (GRCm39)		probably null	Het
Cplane1	T	A	15: 8,300,229 (GRCm39)	S3179T	unknown	Het
Cplx2	A	T	13: 54,526,630 (GRCm39)	T13S	probably benign	Het
Dennd5a	G	A	7: 109,495,550 (GRCm39)	R1194W	probably damaging	Het
Dsc2	T	A	18: 20,183,214 (GRCm39)	D68V	probably damaging	Het
Dus4l	A	C	12: 31,698,827 (GRCm39)	I59R	probably damaging	Het
Edc3	C	T	9: 57,620,829 (GRCm39)	P50L	probably damaging	Het
Ext1	G	A	15: 52,970,987 (GRCm39)		probably benign	Het
Fam219a	C	T	4: 41,518,844 (GRCm39)		probably benign	Het
Fbxl3	A	T	14: 103,329,749 (GRCm39)	D106E	probably damaging	Het
Garem1	T	C	18: 21,369,172 (GRCm39)	N50D	possibly damaging	Het
Gins1	G	A	2: 150,751,682 (GRCm39)	R15H	probably damaging	Het
Icam1	A	G	9: 20,937,608 (GRCm39)	D215G	possibly damaging	Het
Nedd9	A	T	13: 41,471,429 (GRCm39)	I184N	probably damaging	Het
Or10a2	T	C	7: 106,673,799 (GRCm39)	S255P	probably damaging	Het
Or1e21	T	C	11: 73,344,391 (GRCm39)	M216V	probably benign	Het
Otulinl	C	T	15: 27,664,429 (GRCm39)		probably null	Het
Rhot2	A	G	17: 26,061,065 (GRCm39)	C147R	probably damaging	Het
Saxo4	T	C	19: 10,452,385 (GRCm39)	Y375C	probably damaging	Het
Setd4	T	C	16: 93,380,574 (GRCm39)		probably null	Het
Slc6a4	A	G	11: 76,907,904 (GRCm39)	N356S	probably damaging	Het
Tas2r136	C	A	6: 132,754,972 (GRCm39)	V52L	probably damaging	Het
Tmem168	A	C	6: 13,595,072 (GRCm39)	I381S	probably benign	Het
Tnfrsf11b	T	A	15: 54,119,555 (GRCm39)	T140S	possibly damaging	Het
Ttpa	G	T	4: 20,023,827 (GRCm39)	E130*	probably null	Het
Ubr5	A	G	15: 38,078,647 (GRCm39)	V8A	probably damaging	Het
Vmn2r18	C	T	5: 151,496,368 (GRCm39)	C450Y	probably damaging	Het
Vmn2r32	A	T	7: 7,482,857 (GRCm39)	L39*	probably null	Het

Other mutations in Glrx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02161:Glrx2	APN	1	143,615,421 (GRCm39)	missense	possibly damaging	0.66
R1728:Glrx2	UTSW	1	143,615,478 (GRCm39)	missense	possibly damaging	0.90
R1762:Glrx2	UTSW	1	143,615,478 (GRCm39)	missense	possibly damaging	0.90
R1783:Glrx2	UTSW	1	143,615,478 (GRCm39)	missense	possibly damaging	0.90
R1784:Glrx2	UTSW	1	143,615,478 (GRCm39)	missense	possibly damaging	0.90
R1785:Glrx2	UTSW	1	143,615,478 (GRCm39)	missense	possibly damaging	0.90
R2132:Glrx2	UTSW	1	143,620,842 (GRCm39)	missense	possibly damaging	0.92
R5418:Glrx2	UTSW	1	143,615,446 (GRCm39)	missense	possibly damaging	0.83
R5496:Glrx2	UTSW	1	143,620,945 (GRCm39)	missense	probably damaging	0.98
R5952:Glrx2	UTSW	1	143,620,872 (GRCm39)	missense	probably benign	0.03
R6225:Glrx2	UTSW	1	143,621,121 (GRCm39)	intron	probably benign
R9506:Glrx2	UTSW	1	143,622,270 (GRCm39)	nonsense	probably null
R9683:Glrx2	UTSW	1	143,622,292 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTAGAGAAGCACGTGGGTC -3'
(R):5'- TGAAATGGTATAGGACTTGTCACAAGG -3'

Sequencing Primer
(F):5'- CTGGTGTTAGCGGACAAGTAC -3'
(R):5'- GGACTTGTCACAAGGATAACTTTG -3'

Posted On

2015-07-06