Incidental Mutation 'R4362:Ttpa'
ID324941
Institutional Source Beutler Lab
Gene Symbol Ttpa
Ensembl Gene ENSMUSG00000073988
Gene Nametocopherol (alpha) transfer protein
Synonymsalpha-TTP, alpha TTP
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R4362 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location20007938-20030785 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 20023827 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 130 (E130*)
Ref Sequence ENSEMBL: ENSMUSP00000113966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098244] [ENSMUST00000117632] [ENSMUST00000121491] [ENSMUST00000125799]
Predicted Effect probably null
Transcript: ENSMUST00000098244
AA Change: E199*
SMART Domains Protein: ENSMUSP00000095845
Gene: ENSMUSG00000073988
AA Change: E199*

DomainStartEndE-ValueType
CRAL_TRIO_N 48 73 1.64e-6 SMART
SEC14 95 250 1.47e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117632
AA Change: E199*
SMART Domains Protein: ENSMUSP00000113026
Gene: ENSMUSG00000073988
AA Change: E199*

DomainStartEndE-ValueType
CRAL_TRIO_N 48 73 1.64e-6 SMART
SEC14 95 247 1.87e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121491
AA Change: E130*
SMART Domains Protein: ENSMUSP00000113966
Gene: ENSMUSG00000073988
AA Change: E130*

DomainStartEndE-ValueType
SEC14 26 181 1.47e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125799
SMART Domains Protein: ENSMUSP00000117031
Gene: ENSMUSG00000073988

DomainStartEndE-ValueType
Pfam:CRAL_TRIO 26 91 4.9e-9 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a soluble protein that binds alpha-trocopherol, a form of vitamin E, with high selectivity and affinity. This protein plays an important role in regulating vitamin E levels in the body by transporting vitamin E between membrane vesicles and facilitating the secretion of vitamin E from hepatocytes to circulating lipoproteins. Mutations in this gene cause hereditary vitamin E deficiency (ataxia with vitamin E deficiency, AVED) and retinitis pigmentosa. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit vitamin E deficiency. Placentas from pregnant females have reduced labyrinthine trophoblasts resulting in midgestational embryonic lethality. Homozygotes for one targeted null allele display late-onset ataxia and retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Ttpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02932:Ttpa APN 4 20021215 missense possibly damaging 0.83
R0190:Ttpa UTSW 4 20021260 missense probably damaging 1.00
R1950:Ttpa UTSW 4 20008633 missense probably damaging 1.00
R2171:Ttpa UTSW 4 20021357 missense probably damaging 1.00
R5344:Ttpa UTSW 4 20021245 missense probably damaging 0.97
R6111:Ttpa UTSW 4 20014772 missense probably damaging 0.99
R8068:Ttpa UTSW 4 20028419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGTATACGCACACATGAG -3'
(R):5'- AGAGTCTCCCAGCCAGTAATG -3'

Sequencing Primer
(F):5'- TCAAGTACGATGCCCATGG -3'
(R):5'- CCCAGCCAGTAATGATAGATATTTC -3'
Posted On2015-07-06