Incidental Mutation 'R4362:Fam219a'
ID324942
Institutional Source Beutler Lab
Gene Symbol Fam219a
Ensembl Gene ENSMUSG00000028439
Gene Namefamily with sequence similarity 219, member A
Synonyms2310028H24Rik
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4362 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41517691-41569538 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to T at 41518844 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000095126] [ENSMUST00000108049] [ENSMUST00000108050] [ENSMUST00000108052]
Predicted Effect probably benign
Transcript: ENSMUST00000030152
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095126
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108049
SMART Domains Protein: ENSMUSP00000103684
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 26 157 2.7e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108050
SMART Domains Protein: ENSMUSP00000103685
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 26 156 8.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108052
SMART Domains Protein: ENSMUSP00000103687
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 37 168 1.6e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151164
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has homologs that have been identified in mouse, macaque, etc organisms. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Fam219a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Fam219a APN 4 41521684 missense probably benign 0.34
R0607:Fam219a UTSW 4 41520242 makesense probably null
R4659:Fam219a UTSW 4 41521645 missense probably null 0.56
R5438:Fam219a UTSW 4 41520302 missense probably damaging 0.98
R7025:Fam219a UTSW 4 41521925 missense probably benign 0.07
R7563:Fam219a UTSW 4 41569208 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTTCAGCCATGGGAGAG -3'
(R):5'- CGCTTGGGAATGAGAATGC -3'

Sequencing Primer
(F):5'- ATGGGAGAGCCACCATCTC -3'
(R):5'- TGAAAGCACAGCCTGGC -3'
Posted On2015-07-06