Incidental Mutation 'R4362:Vmn2r18'
ID324944
Institutional Source Beutler Lab
Gene Symbol Vmn2r18
Ensembl Gene ENSMUSG00000091794
Gene Namevomeronasal 2, receptor 18
SynonymsEG632671
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4362 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location151561661-151586906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 151572903 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 450 (C450Y)
Ref Sequence ENSEMBL: ENSMUSP00000127506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165928]
Predicted Effect probably damaging
Transcript: ENSMUST00000165928
AA Change: C450Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127506
Gene: ENSMUSG00000091794
AA Change: C450Y

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 403 5.7e-39 PFAM
Pfam:NCD3G 446 499 5.5e-20 PFAM
Pfam:7tm_3 531 767 5e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Vmn2r18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Vmn2r18 APN 5 151572831 missense probably damaging 0.99
IGL01564:Vmn2r18 APN 5 151585168 missense possibly damaging 0.69
IGL01602:Vmn2r18 APN 5 151586641 missense possibly damaging 0.64
IGL01605:Vmn2r18 APN 5 151586641 missense possibly damaging 0.64
IGL01619:Vmn2r18 APN 5 151586764 missense probably benign 0.25
IGL02177:Vmn2r18 APN 5 151586809 missense possibly damaging 0.76
IGL02682:Vmn2r18 APN 5 151584637 missense probably damaging 0.99
IGL02751:Vmn2r18 APN 5 151584607 missense probably benign 0.09
IGL02977:Vmn2r18 APN 5 151586684 missense probably damaging 1.00
R0089:Vmn2r18 UTSW 5 151584804 missense probably benign 0.00
R0282:Vmn2r18 UTSW 5 151585203 missense probably benign 0.02
R0529:Vmn2r18 UTSW 5 151562523 missense probably damaging 0.99
R0812:Vmn2r18 UTSW 5 151572930 splice site probably benign
R1467:Vmn2r18 UTSW 5 151586836 missense possibly damaging 0.48
R1467:Vmn2r18 UTSW 5 151586836 missense possibly damaging 0.48
R1506:Vmn2r18 UTSW 5 151575634 intron probably null
R1562:Vmn2r18 UTSW 5 151586836 missense probably benign 0.12
R1637:Vmn2r18 UTSW 5 151584757 missense probably damaging 1.00
R1651:Vmn2r18 UTSW 5 151561999 missense probably damaging 1.00
R1883:Vmn2r18 UTSW 5 151575725 missense probably benign 0.37
R1884:Vmn2r18 UTSW 5 151575725 missense probably benign 0.37
R1914:Vmn2r18 UTSW 5 151575821 missense probably benign 0.02
R2051:Vmn2r18 UTSW 5 151562551 missense possibly damaging 0.90
R2056:Vmn2r18 UTSW 5 151584695 missense probably damaging 0.98
R2252:Vmn2r18 UTSW 5 151584976 missense possibly damaging 0.59
R2265:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2266:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2267:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2843:Vmn2r18 UTSW 5 151562284 missense probably damaging 1.00
R3023:Vmn2r18 UTSW 5 151561683 missense probably benign 0.13
R3694:Vmn2r18 UTSW 5 151584568 missense probably benign 0.00
R3763:Vmn2r18 UTSW 5 151585179 missense probably damaging 1.00
R3816:Vmn2r18 UTSW 5 151561683 missense probably benign 0.13
R4007:Vmn2r18 UTSW 5 151585246 missense probably damaging 0.99
R4152:Vmn2r18 UTSW 5 151562265 missense probably damaging 1.00
R4308:Vmn2r18 UTSW 5 151584803 nonsense probably null
R4618:Vmn2r18 UTSW 5 151584959 missense possibly damaging 0.64
R4716:Vmn2r18 UTSW 5 151562137 missense possibly damaging 0.87
R4817:Vmn2r18 UTSW 5 151585432 intron probably null
R5111:Vmn2r18 UTSW 5 151562448 missense possibly damaging 0.85
R5692:Vmn2r18 UTSW 5 151562259 missense possibly damaging 0.65
R6115:Vmn2r18 UTSW 5 151584997 missense possibly damaging 0.81
R6244:Vmn2r18 UTSW 5 151584651 missense probably damaging 1.00
R6595:Vmn2r18 UTSW 5 151562424 missense probably damaging 1.00
R6997:Vmn2r18 UTSW 5 151561873 missense possibly damaging 0.95
R7227:Vmn2r18 UTSW 5 151572799 missense probably damaging 1.00
R7349:Vmn2r18 UTSW 5 151562217 nonsense probably null
R7506:Vmn2r18 UTSW 5 151585020 missense possibly damaging 0.51
R7590:Vmn2r18 UTSW 5 151561729 missense probably damaging 1.00
R7721:Vmn2r18 UTSW 5 151586693 missense possibly damaging 0.53
R7877:Vmn2r18 UTSW 5 151584972 missense probably damaging 1.00
R7882:Vmn2r18 UTSW 5 151561864 missense probably damaging 1.00
R7960:Vmn2r18 UTSW 5 151584972 missense probably damaging 1.00
R7965:Vmn2r18 UTSW 5 151561864 missense probably damaging 1.00
Z1176:Vmn2r18 UTSW 5 151585033 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACTGATTACTAATGGATGTGGG -3'
(R):5'- AGCAATGGAAAGTATGCCAACTTC -3'

Sequencing Primer
(F):5'- CAGTGCTGCAATATGATGCC -3'
(R):5'- TGGAAAGTATGCCAACTTCAACTC -3'
Posted On2015-07-06