Incidental Mutation 'R4362:Tmem168'
ID324945
Institutional Source Beutler Lab
Gene Symbol Tmem168
Ensembl Gene ENSMUSG00000029569
Gene Nametransmembrane protein 168
Synonyms5730526F17Rik, 8430437G11Rik
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4362 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location13580687-13608100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 13595073 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 381 (I381S)
Ref Sequence ENSEMBL: ENSMUSP00000031554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031554] [ENSMUST00000149123]
Predicted Effect probably benign
Transcript: ENSMUST00000031554
AA Change: I381S

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031554
Gene: ENSMUSG00000029569
AA Change: I381S

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 109 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 199 216 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
transmembrane domain 298 320 N/A INTRINSIC
transmembrane domain 359 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149123
SMART Domains Protein: ENSMUSP00000145372
Gene: ENSMUSG00000029569

DomainStartEndE-ValueType
SCOP:d1jxqa_ 29 167 8e-3 SMART
Meta Mutation Damage Score 0.1586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Tmem168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Tmem168 APN 6 13602675 missense probably benign 0.06
IGL01305:Tmem168 APN 6 13583046 missense probably damaging 1.00
IGL01843:Tmem168 APN 6 13582941 missense probably damaging 1.00
IGL02742:Tmem168 APN 6 13603262 missense probably benign 0.04
IGL02863:Tmem168 APN 6 13582918 missense probably damaging 0.98
ANU22:Tmem168 UTSW 6 13583046 missense probably damaging 1.00
R0193:Tmem168 UTSW 6 13583313 missense possibly damaging 0.81
R0537:Tmem168 UTSW 6 13603361 missense probably damaging 1.00
R0630:Tmem168 UTSW 6 13583065 missense probably benign
R0890:Tmem168 UTSW 6 13603272 missense probably damaging 1.00
R1416:Tmem168 UTSW 6 13591401 missense probably damaging 0.96
R1900:Tmem168 UTSW 6 13583071 missense probably benign 0.02
R3947:Tmem168 UTSW 6 13583052 missense probably damaging 1.00
R4620:Tmem168 UTSW 6 13594953 missense probably benign 0.03
R5693:Tmem168 UTSW 6 13602321 missense probably benign 0.01
R6142:Tmem168 UTSW 6 13591369 missense probably benign
R6328:Tmem168 UTSW 6 13602711 missense probably benign
R6438:Tmem168 UTSW 6 13602674 missense probably benign 0.06
R6711:Tmem168 UTSW 6 13603121 missense probably damaging 1.00
R6827:Tmem168 UTSW 6 13582838 missense probably damaging 0.99
R6987:Tmem168 UTSW 6 13591477 missense possibly damaging 0.82
R7696:Tmem168 UTSW 6 13602938 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTAGCTTTAGACACAAGGAAC -3'
(R):5'- CATTGCTCTGGTAATTCGTCTG -3'

Sequencing Primer
(F):5'- CTAGCTTTAGACACAAGGAACAATTG -3'
(R):5'- AATTCGTCTGTGTCTGCAGATTG -3'
Posted On2015-07-06