Incidental Mutation 'R4362:Vmn2r32'
ID324947
Institutional Source Beutler Lab
Gene Symbol Vmn2r32
Ensembl Gene ENSMUSG00000096743
Gene Namevomeronasal 2, receptor 32
SynonymsV2r5
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4362 (G1)
Quality Score101
Status Not validated
Chromosome7
Chromosomal Location7463015-7479973 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 7479858 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 39 (L39*)
Ref Sequence ENSEMBL: ENSMUSP00000092462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094866]
Predicted Effect probably null
Transcript: ENSMUST00000094866
AA Change: L39*
SMART Domains Protein: ENSMUSP00000092462
Gene: ENSMUSG00000096743
AA Change: L39*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 3.6e-33 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 9.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Other mutations in Vmn2r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Vmn2r32 APN 7 7476697 missense probably damaging 0.97
IGL02333:Vmn2r32 APN 7 7464144 missense probably damaging 1.00
IGL02406:Vmn2r32 APN 7 7476710 missense probably benign
IGL02428:Vmn2r32 APN 7 7474284 missense probably benign 0.02
IGL02484:Vmn2r32 APN 7 7464117 missense probably damaging 1.00
IGL03277:Vmn2r32 APN 7 7474252 missense probably benign 0.23
IGL03366:Vmn2r32 APN 7 7464030 missense probably damaging 0.99
R1055:Vmn2r32 UTSW 7 7474327 nonsense probably null
R1695:Vmn2r32 UTSW 7 7463992 missense probably benign 0.01
R2172:Vmn2r32 UTSW 7 7474615 missense probably damaging 0.99
R2262:Vmn2r32 UTSW 7 7474619 missense probably benign
R3150:Vmn2r32 UTSW 7 7472555 missense probably benign
R4432:Vmn2r32 UTSW 7 7479919 missense probably damaging 0.98
R4851:Vmn2r32 UTSW 7 7479954 missense possibly damaging 0.59
R4949:Vmn2r32 UTSW 7 7464084 missense probably benign 0.22
R5990:Vmn2r32 UTSW 7 7479810 missense probably damaging 0.97
R6083:Vmn2r32 UTSW 7 7464210 missense probably benign 0.15
R6084:Vmn2r32 UTSW 7 7464210 missense probably benign 0.15
R6116:Vmn2r32 UTSW 7 7464093 missense probably damaging 1.00
R6263:Vmn2r32 UTSW 7 7476692 missense possibly damaging 0.90
R6889:Vmn2r32 UTSW 7 7472574 missense possibly damaging 0.82
R7286:Vmn2r32 UTSW 7 7479808 missense probably benign 0.21
R7390:Vmn2r32 UTSW 7 7479852 missense probably benign 0.00
R7412:Vmn2r32 UTSW 7 7474213 missense possibly damaging 0.53
R7508:Vmn2r32 UTSW 7 7467374 missense possibly damaging 0.87
Z1177:Vmn2r32 UTSW 7 7474161 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGGTTGTTTCTCAGAGTTCAGAC -3'
(R):5'- AGCTGGTAGAAATCTGATGTGC -3'

Sequencing Primer
(F):5'- TTCTCAGAGTTCAGACTTAGCACCAG -3'
(R):5'- GTGCTGATATGCATGGCACTTCAC -3'
Posted On2015-07-06