Mutagenetix > Incidental Mutations

Incidental Mutation 'R4362:Vmn2r32'

324947

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r32

Ensembl Gene

ENSMUSG00000096743

Gene Name

vomeronasal 2, receptor 32

Synonyms

V2r5

MMRRC Submission

041671-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R4362 (G1)

Quality Score

101

Status

Not validated

Chromosome

Chromosomal Location

7463015-7479973 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 7479858 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 39 (L39*)

Ref Sequence

ENSEMBL: ENSMUSP00000092462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094866]

Predicted Effect

probably null
Transcript: ENSMUST00000094866
AA Change: L39*

SMART Domains

Protein: ENSMUSP00000092462
Gene: ENSMUSG00000096743
AA Change: L39*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	470	3.6e-33	PFAM
Pfam:NCD3G	512	565	8.1e-21	PFAM
Pfam:7tm_3	598	833	9.5e-55	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	C	T	7: 29,248,262		probably benign	Het
2410089E03Rik	T	A	15: 8,270,745	S3179T	unknown	Het
Abcc6	A	G	7: 45,998,832		probably benign	Het
Adamts13	G	A	2: 27,004,782	C1034Y	probably damaging	Het
Atp2b4	G	T	1: 133,739,931	P125Q	possibly damaging	Het
Atp8b1	C	T	18: 64,564,537	R412H	probably damaging	Het
Bicc1	ATGTG	ATG	10: 70,943,374		probably null	Het
Cap1	G	A	4: 122,862,987	P302S	probably benign	Het
Chodl	G	T	16: 78,944,658		probably null	Het
Cplx2	A	T	13: 54,378,817	T13S	probably benign	Het
Dennd5a	G	A	7: 109,896,343	R1194W	probably damaging	Het
Dsc2	T	A	18: 20,050,157	D68V	probably damaging	Het
Dus4l	A	C	12: 31,648,828	I59R	probably damaging	Het
Edc3	C	T	9: 57,713,546	P50L	probably damaging	Het
Ext1	G	A	15: 53,107,591		probably benign	Het
Fam105a	C	T	15: 27,664,343		probably null	Het
Fam219a	C	T	4: 41,518,844		probably benign	Het
Fbxl3	A	T	14: 103,092,313	D106E	probably damaging	Het
Garem1	T	C	18: 21,236,115	N50D	possibly damaging	Het
Gins1	G	A	2: 150,909,762	R15H	probably damaging	Het
Glrx2	A	G	1: 143,741,680	K44R	possibly damaging	Het
Icam1	A	G	9: 21,026,312	D215G	possibly damaging	Het
Nedd9	A	T	13: 41,317,953	I184N	probably damaging	Het
Olfr380	T	C	11: 73,453,565	M216V	probably benign	Het
Olfr714	T	C	7: 107,074,592	S255P	probably damaging	Het
Ppp1r32	T	C	19: 10,475,021	Y375C	probably damaging	Het
Rhot2	A	G	17: 25,842,091	C147R	probably damaging	Het
Setd4	T	C	16: 93,583,686		probably null	Het
Slc6a4	A	G	11: 77,017,078	N356S	probably damaging	Het
Tas2r136	C	A	6: 132,778,009	V52L	probably damaging	Het
Tmem168	A	C	6: 13,595,073	I381S	probably benign	Het
Tnfrsf11b	T	A	15: 54,256,159	T140S	possibly damaging	Het
Ttpa	G	T	4: 20,023,827	E130*	probably null	Het
Ubr5	A	G	15: 38,078,403	V8A	probably damaging	Het
Vmn2r18	C	T	5: 151,572,903	C450Y	probably damaging	Het

Other mutations in Vmn2r32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02140:Vmn2r32	APN	7	7476697	missense	probably damaging	0.97
IGL02333:Vmn2r32	APN	7	7464144	missense	probably damaging	1.00
IGL02406:Vmn2r32	APN	7	7476710	missense	probably benign
IGL02428:Vmn2r32	APN	7	7474284	missense	probably benign	0.02
IGL02484:Vmn2r32	APN	7	7464117	missense	probably damaging	1.00
IGL03277:Vmn2r32	APN	7	7474252	missense	probably benign	0.23
IGL03366:Vmn2r32	APN	7	7464030	missense	probably damaging	0.99
R1055:Vmn2r32	UTSW	7	7474327	nonsense	probably null
R1695:Vmn2r32	UTSW	7	7463992	missense	probably benign	0.01
R2172:Vmn2r32	UTSW	7	7474615	missense	probably damaging	0.99
R2262:Vmn2r32	UTSW	7	7474619	missense	probably benign
R3150:Vmn2r32	UTSW	7	7472555	missense	probably benign
R4432:Vmn2r32	UTSW	7	7479919	missense	probably damaging	0.98
R4851:Vmn2r32	UTSW	7	7479954	missense	possibly damaging	0.59
R4949:Vmn2r32	UTSW	7	7464084	missense	probably benign	0.22
R5990:Vmn2r32	UTSW	7	7479810	missense	probably damaging	0.97
R6083:Vmn2r32	UTSW	7	7464210	missense	probably benign	0.15
R6084:Vmn2r32	UTSW	7	7464210	missense	probably benign	0.15
R6116:Vmn2r32	UTSW	7	7464093	missense	probably damaging	1.00
R6263:Vmn2r32	UTSW	7	7476692	missense	possibly damaging	0.90
R6889:Vmn2r32	UTSW	7	7472574	missense	possibly damaging	0.82
R7286:Vmn2r32	UTSW	7	7479808	missense	probably benign	0.21
R7390:Vmn2r32	UTSW	7	7479852	missense	probably benign	0.00
R7412:Vmn2r32	UTSW	7	7474213	missense	possibly damaging	0.53
R7508:Vmn2r32	UTSW	7	7467374	missense	possibly damaging	0.87
Z1177:Vmn2r32	UTSW	7	7474161	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGGTTGTTTCTCAGAGTTCAGAC -3'
(R):5'- AGCTGGTAGAAATCTGATGTGC -3'

Sequencing Primer
(F):5'- TTCTCAGAGTTCAGACTTAGCACCAG -3'
(R):5'- GTGCTGATATGCATGGCACTTCAC -3'

Posted On

2015-07-06