Incidental Mutation 'R4362:Olfr714'
ID324951
Institutional Source Beutler Lab
Gene Symbol Olfr714
Ensembl Gene ENSMUSG00000049674
Gene Nameolfactory receptor 714
SynonymsGA_x6K02T2PBJ9-9453401-9454354, P4, MOR263-2
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4362 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location107070981-107077802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107074592 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 255 (S255P)
Ref Sequence ENSEMBL: ENSMUSP00000151106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054629] [ENSMUST00000214429]
Predicted Effect probably damaging
Transcript: ENSMUST00000054629
AA Change: S255P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095742
Gene: ENSMUSG00000049674
AA Change: S255P

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.5e-56 PFAM
Pfam:7tm_1 42 291 3.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214123
Predicted Effect probably damaging
Transcript: ENSMUST00000214429
AA Change: S255P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.7122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal olfactory sensory neuron projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Olfr714
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Olfr714 APN 7 107074493 missense probably damaging 0.98
IGL02562:Olfr714 APN 7 107074562 missense probably benign 0.03
IGL02597:Olfr714 APN 7 107074439 missense possibly damaging 0.89
IGL02598:Olfr714 APN 7 107074716 missense possibly damaging 0.64
IGL02981:Olfr714 APN 7 107074551 missense probably damaging 1.00
R0064:Olfr714 UTSW 7 107074280 missense probably benign 0.02
R0064:Olfr714 UTSW 7 107074280 missense probably benign 0.02
R0518:Olfr714 UTSW 7 107074758 missense possibly damaging 0.81
R0521:Olfr714 UTSW 7 107074758 missense possibly damaging 0.81
R1661:Olfr714 UTSW 7 107074274 missense probably damaging 1.00
R1665:Olfr714 UTSW 7 107074274 missense probably damaging 1.00
R2069:Olfr714 UTSW 7 107074619 nonsense probably null
R2202:Olfr714 UTSW 7 107074316 missense probably damaging 1.00
R3884:Olfr714 UTSW 7 107073903 missense possibly damaging 0.72
R4618:Olfr714 UTSW 7 107074554 missense probably damaging 1.00
R5375:Olfr714 UTSW 7 107073873 missense probably benign 0.05
R5654:Olfr714 UTSW 7 107074187 missense probably damaging 1.00
R6228:Olfr714 UTSW 7 107074136 missense probably damaging 1.00
R7196:Olfr714 UTSW 7 107074728 missense probably benign 0.01
R7202:Olfr714 UTSW 7 107074241 missense probably benign 0.01
R7232:Olfr714 UTSW 7 107073855 missense probably benign 0.03
Z1088:Olfr714 UTSW 7 107074405 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TGAATCACTTCTTCTGTGACAGCC -3'
(R):5'- CAGGGCCTTGTGGAAAGTTC -3'

Sequencing Primer
(F):5'- AGACACAGCCCGGTTTGAG -3'
(R):5'- CCTTGTGGAAAGTTCTGCTGAG -3'
Posted On2015-07-06