Incidental Mutation 'R4362:Slc6a4'
ID324956
Institutional Source Beutler Lab
Gene Symbol Slc6a4
Ensembl Gene ENSMUSG00000020838
Gene Namesolute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Synonyms5-HTT, Sert, Htt
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R4362 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location76998603-77032340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77017078 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 356 (N356S)
Ref Sequence ENSEMBL: ENSMUSP00000104039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021195] [ENSMUST00000108402] [ENSMUST00000129572]
Predicted Effect probably damaging
Transcript: ENSMUST00000021195
AA Change: N356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021195
Gene: ENSMUSG00000020838
AA Change: N356S

DomainStartEndE-ValueType
Pfam:5HT_transport_N 24 64 3e-27 PFAM
Pfam:SNF 79 600 7.3e-232 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108402
AA Change: N356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104039
Gene: ENSMUSG00000020838
AA Change: N356S

DomainStartEndE-ValueType
Pfam:5HT_transporter 23 64 7.8e-30 PFAM
Pfam:SNF 79 600 7.3e-232 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129572
SMART Domains Protein: ENSMUSP00000115264
Gene: ENSMUSG00000020838

DomainStartEndE-ValueType
Pfam:5HT_transporter 23 64 1e-30 PFAM
Pfam:SNF 79 158 1.8e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137819
Meta Mutation Damage Score 0.5979 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake and may play a role in sudden infant death syndrome, aggressive behavior in Alzheimer disease patients, and depression-susceptibility in people experiencing emotional trauma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit greatly diminished brain serotonin levels and lack cortical barrel patterns. Also, mutants lack the locomotor enhancing response to the drug (+)-3,4-methylenedioxymethamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Slc6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Slc6a4 APN 11 77023180 missense probably benign 0.00
IGL01403:Slc6a4 APN 11 77031672 missense probably benign 0.00
IGL01608:Slc6a4 APN 11 77027135 missense probably damaging 1.00
IGL01759:Slc6a4 APN 11 77013288 missense probably damaging 1.00
IGL02239:Slc6a4 APN 11 77027156 missense probably benign 0.01
IGL02491:Slc6a4 APN 11 77027208 missense probably damaging 1.00
IGL03221:Slc6a4 APN 11 77027105 missense probably benign
R1122:Slc6a4 UTSW 11 77027186 missense possibly damaging 0.90
R1574:Slc6a4 UTSW 11 77019196 missense possibly damaging 0.93
R1574:Slc6a4 UTSW 11 77019196 missense possibly damaging 0.93
R1768:Slc6a4 UTSW 11 77013252 missense probably damaging 1.00
R1876:Slc6a4 UTSW 11 77015164 missense probably benign 0.34
R1884:Slc6a4 UTSW 11 77013375 missense probably benign 0.01
R4595:Slc6a4 UTSW 11 77019863 missense probably benign 0.16
R4855:Slc6a4 UTSW 11 77013309 missense probably damaging 1.00
R5569:Slc6a4 UTSW 11 77023255 missense possibly damaging 0.88
R5747:Slc6a4 UTSW 11 77010511 missense probably damaging 0.97
R5802:Slc6a4 UTSW 11 77019236 missense probably damaging 1.00
R6242:Slc6a4 UTSW 11 77018358 nonsense probably null
R6344:Slc6a4 UTSW 11 77018254 missense probably damaging 1.00
R6443:Slc6a4 UTSW 11 77023201 missense probably benign 0.05
R6935:Slc6a4 UTSW 11 77027168 missense probably benign 0.06
R7283:Slc6a4 UTSW 11 77010696 missense probably benign
R7313:Slc6a4 UTSW 11 77010701 missense possibly damaging 0.75
R7347:Slc6a4 UTSW 11 77017085 nonsense probably null
R7535:Slc6a4 UTSW 11 77015150 missense possibly damaging 0.70
R7826:Slc6a4 UTSW 11 77013025 missense probably benign 0.27
R8055:Slc6a4 UTSW 11 77010598 missense probably benign 0.00
RF007:Slc6a4 UTSW 11 77019182 missense probably damaging 1.00
Z1177:Slc6a4 UTSW 11 77016683 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCTTTCGATCTGAAATCAAGGC -3'
(R):5'- GTGTAAAGTTACTTCCTGAACGGG -3'

Sequencing Primer
(F):5'- TAGCACAGCATCTTGAGGCTACTG -3'
(R):5'- ACGGGCTTGAGATCATTG -3'
Posted On2015-07-06