Incidental Mutation 'R4362:Cplx2'
ID324959
Institutional Source Beutler Lab
Gene Symbol Cplx2
Ensembl Gene ENSMUSG00000025867
Gene Namecomplexin 2
Synonyms921-L
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4362 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54371349-54383917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54378817 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 13 (T13S)
Ref Sequence ENSEMBL: ENSMUSP00000026985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026985]
Predicted Effect probably benign
Transcript: ENSMUST00000026985
AA Change: T13S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000026985
Gene: ENSMUSG00000025867
AA Change: T13S

DomainStartEndE-ValueType
Pfam:Synaphin 1 133 3.1e-45 PFAM
Meta Mutation Damage Score 0.0773 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins encoded by the complexin/synaphin gene family are cytosolic proteins that function in synaptic vesicle exocytosis. These proteins bind syntaxin, part of the SNAP receptor. The protein product of this gene binds to the SNAP receptor complex and disrupts it, allowing transmitter release. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a variety of neurological abnormalities related to coordination, learning, and social interaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Cplx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1239:Cplx2 UTSW 13 54379602 missense probably damaging 0.99
R4280:Cplx2 UTSW 13 54379564 missense probably damaging 1.00
R4283:Cplx2 UTSW 13 54379564 missense probably damaging 1.00
R4363:Cplx2 UTSW 13 54378817 missense probably benign 0.02
R4649:Cplx2 UTSW 13 54379548 missense probably benign 0.14
R4965:Cplx2 UTSW 13 54379647 missense possibly damaging 0.95
R5165:Cplx2 UTSW 13 54378976 missense possibly damaging 0.80
R5465:Cplx2 UTSW 13 54379539 missense possibly damaging 0.95
R6193:Cplx2 UTSW 13 54379593 missense probably damaging 1.00
R6642:Cplx2 UTSW 13 54378923 missense probably damaging 0.98
R7361:Cplx2 UTSW 13 54378826 missense probably benign 0.06
R7422:Cplx2 UTSW 13 54378850 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ATTTCCCAAAGGCAGACCAG -3'
(R):5'- ACCTTGTCTCGGATCTGCTG -3'

Sequencing Primer
(F):5'- TGAATGCGAATTCAGCCACG -3'
(R):5'- GATCTGCTGCCGGACCTTC -3'
Posted On2015-07-06