Incidental Mutation 'R4362:Tnfrsf11b'
ID 324966
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11b
Ensembl Gene ENSMUSG00000063727
Gene Name tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)
Synonyms Opg, OCIF, OPG, TR1, osteoclastogenesis inhibitory factor
MMRRC Submission 041671-MU
Accession Numbers

NCBI RefSeq: NM_008764.3; MGI:109587
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R4362 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 54250619-54278484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54256159 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 140 (T140S)
Ref Sequence ENSEMBL: ENSMUSP00000078705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079772]
AlphaFold O08712
PDB Structure Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079772
AA Change: T140S

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078705
Gene: ENSMUSG00000063727
AA Change: T140S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 24 62 1.04e-2 SMART
TNFR 65 105 1.5e-8 SMART
TNFR 107 142 2.19e-10 SMART
TNFR 145 185 7.63e-1 SMART
DEATH 270 365 1.01e-9 SMART
Meta Mutation Damage Score 0.4789 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype Strain: 2181227
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have abnormal bone remodeling that results in severe osteoperosis with increased risk of fractures and growth retardation. Progressive hearing loss also results due to abnormal remodeling of the otic capsule. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Tnfrsf11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnfrsf11b APN 15 54259842 missense probably damaging 1.00
IGL00770:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL00774:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL02355:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02362:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02711:Tnfrsf11b APN 15 54256136 missense probably benign 0.01
IGL02870:Tnfrsf11b APN 15 54256027 missense probably benign 0.05
IGL03219:Tnfrsf11b APN 15 54254178 nonsense probably null
P0012:Tnfrsf11b UTSW 15 54259798 splice site probably benign
R1550:Tnfrsf11b UTSW 15 54254058 missense possibly damaging 0.94
R1813:Tnfrsf11b UTSW 15 54256097 nonsense probably null
R3840:Tnfrsf11b UTSW 15 54252082 missense probably damaging 0.99
R3910:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3911:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3912:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R4299:Tnfrsf11b UTSW 15 54252095 missense probably benign
R4363:Tnfrsf11b UTSW 15 54256159 missense possibly damaging 0.94
R5288:Tnfrsf11b UTSW 15 54278226 missense probably benign 0.00
R5653:Tnfrsf11b UTSW 15 54259866 missense probably damaging 1.00
R5753:Tnfrsf11b UTSW 15 54254059 missense possibly damaging 0.90
R6881:Tnfrsf11b UTSW 15 54254143 missense probably benign 0.00
R6997:Tnfrsf11b UTSW 15 54252374 missense probably damaging 0.99
R7704:Tnfrsf11b UTSW 15 54260101 missense probably benign 0.30
R7730:Tnfrsf11b UTSW 15 54254074 nonsense probably null
R8017:Tnfrsf11b UTSW 15 54254202 nonsense probably null
R8052:Tnfrsf11b UTSW 15 54252106 missense probably damaging 1.00
R8060:Tnfrsf11b UTSW 15 54254109 missense probably benign 0.38
R8711:Tnfrsf11b UTSW 15 54260112 missense possibly damaging 0.81
R9224:Tnfrsf11b UTSW 15 54252160 missense possibly damaging 0.67
X0025:Tnfrsf11b UTSW 15 54278235 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGGCATGCTGTGTATAGTTACC -3'
(R):5'- AGCGCAACAAACTTGTGTGG -3'

Sequencing Primer
(F):5'- GCATGCTGTGTATAGTTACCTATTC -3'
(R):5'- CGCAACAAACTTGTGTGGGTATTAC -3'
Posted On 2015-07-06