Incidental Mutation 'R4362:Setd4'
ID324969
Institutional Source Beutler Lab
Gene Symbol Setd4
Ensembl Gene ENSMUSG00000022948
Gene NameSET domain containing 4
SynonymsORF21
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4362 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location93583457-93604063 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 93583686 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023669] [ENSMUST00000023669] [ENSMUST00000113951] [ENSMUST00000113951]
Predicted Effect probably null
Transcript: ENSMUST00000023669
SMART Domains Protein: ENSMUSP00000023669
Gene: ENSMUSG00000022948

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:SET 58 272 3.2e-11 PFAM
Pfam:Rubis-subs-bind 306 424 5.5e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000023669
SMART Domains Protein: ENSMUSP00000023669
Gene: ENSMUSG00000022948

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:SET 58 272 3.2e-11 PFAM
Pfam:Rubis-subs-bind 306 424 5.5e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113951
SMART Domains Protein: ENSMUSP00000109584
Gene: ENSMUSG00000022948

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:SET 58 272 9.1e-14 PFAM
Pfam:Rubis-subs-bind 308 424 1e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113951
SMART Domains Protein: ENSMUSP00000109584
Gene: ENSMUSG00000022948

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:SET 58 272 9.1e-14 PFAM
Pfam:Rubis-subs-bind 308 424 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152520
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Setd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Setd4 APN 16 93591239 missense probably damaging 1.00
IGL02217:Setd4 APN 16 93593295 missense probably damaging 1.00
R0370:Setd4 UTSW 16 93591118 missense probably damaging 0.99
R0573:Setd4 UTSW 16 93589946 missense probably benign
R1103:Setd4 UTSW 16 93585194 missense probably benign 0.01
R1631:Setd4 UTSW 16 93593248 nonsense probably null
R1826:Setd4 UTSW 16 93591299 nonsense probably null
R2356:Setd4 UTSW 16 93590983 missense probably damaging 1.00
R2360:Setd4 UTSW 16 93586234 splice site probably benign
R4630:Setd4 UTSW 16 93591226 missense probably benign 0.00
R4823:Setd4 UTSW 16 93589950 missense probably benign 0.00
R5004:Setd4 UTSW 16 93591245 missense probably benign 0.02
R5257:Setd4 UTSW 16 93596333 missense probably damaging 0.98
R6667:Setd4 UTSW 16 93590030 missense probably benign 0.16
R6798:Setd4 UTSW 16 93589953 missense probably damaging 1.00
R7296:Setd4 UTSW 16 93583942 intron probably null
R7313:Setd4 UTSW 16 93591244 missense probably benign 0.09
R7314:Setd4 UTSW 16 93587823 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTTTATTCCAACCTCAGTAAAGACG -3'
(R):5'- GGATTCCCCAGAGCAGTGATTC -3'

Sequencing Primer
(F):5'- CGCTGGTACATCCTCCATAGG -3'
(R):5'- AGAGCAGTGATTCCCTACACGTTC -3'
Posted On2015-07-06