Incidental Mutation 'R4362:Garem1'
ID 324972
Institutional Source Beutler Lab
Gene Symbol Garem1
Ensembl Gene ENSMUSG00000042680
Gene Name GRB2 associated regulator of MAPK1 subtype 1
Synonyms Garem, Fam59a, LOC381126
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock # R4362 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 21127201-21300138 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21236115 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 50 (N50D)
Ref Sequence ENSEMBL: ENSMUSP00000048914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049260]
AlphaFold Q3UFT3
Predicted Effect possibly damaging
Transcript: ENSMUST00000049260
AA Change: N50D

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: N50D

DomainStartEndE-ValueType
Pfam:CABIT 32 318 3.4e-79 PFAM
low complexity region 484 499 N/A INTRINSIC
low complexity region 512 518 N/A INTRINSIC
PDB:2DKZ|A 795 874 2e-40 PDB
Blast:SAM 808 875 2e-36 BLAST
SCOP:d1kw4a_ 812 873 4e-4 SMART
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Garem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Garem1 APN 18 21148657 missense probably damaging 1.00
IGL01588:Garem1 APN 18 21129797 missense probably damaging 0.99
IGL02171:Garem1 APN 18 21129241 missense probably damaging 0.98
IGL02270:Garem1 APN 18 21148450 missense probably damaging 1.00
IGL03149:Garem1 APN 18 21131466 missense probably damaging 1.00
R0136:Garem1 UTSW 18 21129991 missense probably damaging 0.96
R0285:Garem1 UTSW 18 21129612 missense probably benign
R0361:Garem1 UTSW 18 21299744 nonsense probably null
R1068:Garem1 UTSW 18 21168755 missense probably benign 0.00
R1537:Garem1 UTSW 18 21168874 splice site probably null
R1726:Garem1 UTSW 18 21148262 missense probably damaging 0.99
R1826:Garem1 UTSW 18 21129452 missense probably benign 0.00
R2140:Garem1 UTSW 18 21129374 missense probably damaging 1.00
R3714:Garem1 UTSW 18 21148890 missense probably damaging 1.00
R3937:Garem1 UTSW 18 21148806 nonsense probably null
R4441:Garem1 UTSW 18 21168750 missense possibly damaging 0.92
R4747:Garem1 UTSW 18 21129943 missense probably benign
R4814:Garem1 UTSW 18 21148116 missense probably damaging 1.00
R4831:Garem1 UTSW 18 21129768 missense probably benign 0.01
R4838:Garem1 UTSW 18 21147893 missense probably benign 0.00
R5805:Garem1 UTSW 18 21148435 missense probably benign 0.04
R5963:Garem1 UTSW 18 21129430 missense probably benign 0.45
R5982:Garem1 UTSW 18 21148351 missense possibly damaging 0.64
R6134:Garem1 UTSW 18 21129824 missense probably benign 0.00
R6242:Garem1 UTSW 18 21129172 missense possibly damaging 0.72
R6453:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6485:Garem1 UTSW 18 21129837 missense probably benign 0.00
R6596:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6662:Garem1 UTSW 18 21148247 missense probably benign 0.45
R6883:Garem1 UTSW 18 21129712 missense probably benign
R6937:Garem1 UTSW 18 21147770 missense probably benign 0.00
R7027:Garem1 UTSW 18 21129994 missense probably benign
R7256:Garem1 UTSW 18 21148754 missense probably damaging 1.00
R7534:Garem1 UTSW 18 21299916 start gained probably benign
R7620:Garem1 UTSW 18 21129841 missense probably benign
R7869:Garem1 UTSW 18 21299700 missense probably damaging 1.00
R7963:Garem1 UTSW 18 21148787 missense probably damaging 0.98
R8058:Garem1 UTSW 18 21148564 missense probably damaging 1.00
R8953:Garem1 UTSW 18 21131331 critical splice donor site probably null
R9273:Garem1 UTSW 18 21148217 missense probably damaging 0.99
R9411:Garem1 UTSW 18 21236000 critical splice donor site probably null
R9475:Garem1 UTSW 18 21148313 missense probably benign 0.00
Z1176:Garem1 UTSW 18 21129792 missense probably damaging 1.00
Z1176:Garem1 UTSW 18 21148325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGGCAATTCCTAGCTC -3'
(R):5'- GGAGAGCCATGTATACCCAAAGC -3'

Sequencing Primer
(F):5'- TGCTACAAGGATAAGATAAAATTGGC -3'
(R):5'- CCTGAACCTAGAGCCTGATGATTG -3'
Posted On 2015-07-06