Incidental Mutation 'R4363:Hus1'
ID324992
Institutional Source Beutler Lab
Gene Symbol Hus1
Ensembl Gene ENSMUSG00000020413
Gene NameHUS1 checkpoint clamp component
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4363 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location8993137-9011191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8998676 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 242 (L242I)
Ref Sequence ENSEMBL: ENSMUSP00000114339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020683] [ENSMUST00000129115]
Predicted Effect probably damaging
Transcript: ENSMUST00000020683
AA Change: L242I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020683
Gene: ENSMUSG00000020413
AA Change: L242I

DomainStartEndE-ValueType
Pfam:Hus1 1 280 5.1e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129115
AA Change: L242I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114339
Gene: ENSMUSG00000020413
AA Change: L242I

DomainStartEndE-ValueType
Pfam:Hus1 1 280 4.8e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152890
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of a cell cycle checkpoint complex that causes cell cycle arrest in response to bulky DNA lesions and DNA replication blockage. Together with the proteins Rad9 and Rad1, the encoded protein forms a heterotrimeric complex known as the 9-1-1 complex. Mice lacking the encoded protein develop spontaneous chromosomal abnormalities resulting in embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in yolk sac vascularization, placental abnormalities, extensive apoptosis, and midgestational lethality. Mutant cells show increased chromosomal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
9530053A07Rik T C 7: 28,146,906 S1008P probably damaging Het
Abcc2 G T 19: 43,799,136 W207L possibly damaging Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Adgrb3 A T 1: 25,112,222 V1081E probably damaging Het
Apcdd1 T A 18: 62,951,932 I400N possibly damaging Het
Bcan G T 3: 87,997,098 T117K probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cmtr1 T C 17: 29,674,232 L75P probably damaging Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Drd3 A T 16: 43,762,359 I72F probably damaging Het
Dsn1 A T 2: 156,999,142 I214K probably benign Het
Ermp1 A T 19: 29,612,876 W809R probably damaging Het
Fam105a C T 15: 27,664,343 probably null Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Fbxo33 T C 12: 59,204,862 H289R probably damaging Het
Gli2 T C 1: 118,853,370 N189S probably benign Het
Hyou1 G A 9: 44,380,615 probably null Het
Kirrel C A 3: 87,090,485 E244* probably null Het
Mmrn2 C T 14: 34,397,977 A268V probably damaging Het
Mycbp2 G T 14: 103,248,457 A1023E probably damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Nmnat1 T C 4: 149,473,445 I47V probably benign Het
Olfr339 A T 2: 36,421,532 I45F probably damaging Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Pak1 T C 7: 97,883,586 S198P possibly damaging Het
Pank1 A C 19: 34,827,132 V208G probably damaging Het
Pcdhga12 C G 18: 37,766,161 F15L probably benign Het
Recql4 T C 15: 76,706,044 D723G probably benign Het
Rgs22 A T 15: 36,103,874 I147N probably damaging Het
Selenbp1 A G 3: 94,942,749 probably null Het
Sspo A G 6: 48,498,731 Y4927C probably damaging Het
Syk A T 13: 52,640,730 H477L probably damaging Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Vmn2r-ps69 T C 7: 85,310,492 noncoding transcript Het
Other mutations in Hus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Hus1 APN 11 9000082 missense probably benign 0.00
IGL01974:Hus1 APN 11 9000088 missense possibly damaging 0.58
IGL02301:Hus1 APN 11 8996915 missense probably benign
IGL02436:Hus1 APN 11 9006057 missense possibly damaging 0.93
R0694:Hus1 UTSW 11 9007531 nonsense probably null
R2108:Hus1 UTSW 11 9011110 start codon destroyed probably null 1.00
R2128:Hus1 UTSW 11 9006011 missense probably damaging 1.00
R2329:Hus1 UTSW 11 9007492 critical splice donor site probably null
R4420:Hus1 UTSW 11 9000133 missense probably damaging 1.00
R4453:Hus1 UTSW 11 9006035 missense probably damaging 1.00
R4572:Hus1 UTSW 11 9007617 splice site probably null
R4818:Hus1 UTSW 11 8996808 utr 3 prime probably benign
R4913:Hus1 UTSW 11 8996856 missense probably benign 0.03
R4989:Hus1 UTSW 11 9006027 missense probably damaging 0.97
R5402:Hus1 UTSW 11 9010240 critical splice donor site probably null
R5902:Hus1 UTSW 11 9010669 intron probably benign
R6402:Hus1 UTSW 11 9010407 missense probably damaging 1.00
R7792:Hus1 UTSW 11 9000133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTAGCATGGCTACTGGC -3'
(R):5'- TAGGGTCTCTCAGTTAGTAAGTAAGC -3'

Sequencing Primer
(F):5'- CTAGCATGGCTACTGGCTTTCTG -3'
(R):5'- CTCAGTTAGTAAGTAAGCACGCTTTG -3'
Posted On2015-07-06