Incidental Mutation 'R4363:Cplx2'
ID324998
Institutional Source Beutler Lab
Gene Symbol Cplx2
Ensembl Gene ENSMUSG00000025867
Gene Namecomplexin 2
Synonyms921-L
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4363 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location54371349-54383917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54378817 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 13 (T13S)
Ref Sequence ENSEMBL: ENSMUSP00000026985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026985]
Predicted Effect probably benign
Transcript: ENSMUST00000026985
AA Change: T13S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000026985
Gene: ENSMUSG00000025867
AA Change: T13S

DomainStartEndE-ValueType
Pfam:Synaphin 1 133 3.1e-45 PFAM
Meta Mutation Damage Score 0.0773 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins encoded by the complexin/synaphin gene family are cytosolic proteins that function in synaptic vesicle exocytosis. These proteins bind syntaxin, part of the SNAP receptor. The protein product of this gene binds to the SNAP receptor complex and disrupts it, allowing transmitter release. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a variety of neurological abnormalities related to coordination, learning, and social interaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
9530053A07Rik T C 7: 28,146,906 S1008P probably damaging Het
Abcc2 G T 19: 43,799,136 W207L possibly damaging Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Adgrb3 A T 1: 25,112,222 V1081E probably damaging Het
Apcdd1 T A 18: 62,951,932 I400N possibly damaging Het
Bcan G T 3: 87,997,098 T117K probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cmtr1 T C 17: 29,674,232 L75P probably damaging Het
Drd3 A T 16: 43,762,359 I72F probably damaging Het
Dsn1 A T 2: 156,999,142 I214K probably benign Het
Ermp1 A T 19: 29,612,876 W809R probably damaging Het
Fam105a C T 15: 27,664,343 probably null Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Fbxo33 T C 12: 59,204,862 H289R probably damaging Het
Gli2 T C 1: 118,853,370 N189S probably benign Het
Hus1 G T 11: 8,998,676 L242I probably damaging Het
Hyou1 G A 9: 44,380,615 probably null Het
Kirrel C A 3: 87,090,485 E244* probably null Het
Mmrn2 C T 14: 34,397,977 A268V probably damaging Het
Mycbp2 G T 14: 103,248,457 A1023E probably damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Nmnat1 T C 4: 149,473,445 I47V probably benign Het
Olfr339 A T 2: 36,421,532 I45F probably damaging Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Pak1 T C 7: 97,883,586 S198P possibly damaging Het
Pank1 A C 19: 34,827,132 V208G probably damaging Het
Pcdhga12 C G 18: 37,766,161 F15L probably benign Het
Recql4 T C 15: 76,706,044 D723G probably benign Het
Rgs22 A T 15: 36,103,874 I147N probably damaging Het
Selenbp1 A G 3: 94,942,749 probably null Het
Sspo A G 6: 48,498,731 Y4927C probably damaging Het
Syk A T 13: 52,640,730 H477L probably damaging Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Vmn2r-ps69 T C 7: 85,310,492 noncoding transcript Het
Other mutations in Cplx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1239:Cplx2 UTSW 13 54379602 missense probably damaging 0.99
R4280:Cplx2 UTSW 13 54379564 missense probably damaging 1.00
R4283:Cplx2 UTSW 13 54379564 missense probably damaging 1.00
R4362:Cplx2 UTSW 13 54378817 missense probably benign 0.02
R4649:Cplx2 UTSW 13 54379548 missense probably benign 0.14
R4965:Cplx2 UTSW 13 54379647 missense possibly damaging 0.95
R5165:Cplx2 UTSW 13 54378976 missense possibly damaging 0.80
R5465:Cplx2 UTSW 13 54379539 missense possibly damaging 0.95
R6193:Cplx2 UTSW 13 54379593 missense probably damaging 1.00
R6642:Cplx2 UTSW 13 54378923 missense probably damaging 0.98
R7361:Cplx2 UTSW 13 54378826 missense probably benign 0.06
R7422:Cplx2 UTSW 13 54378850 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCATTTCCCAAAGGCAGACC -3'
(R):5'- ACCTTGTCTCGGATCTGCTG -3'

Sequencing Primer
(F):5'- TGAATGCGAATTCAGCCACG -3'
(R):5'- GATCTGCTGCCGGACCTTC -3'
Posted On2015-07-06