Incidental Mutation 'R4363:Fam105a'
ID325003
Institutional Source Beutler Lab
Gene Symbol Fam105a
Ensembl Gene ENSMUSG00000056069
Gene Namefamily with sequence similarity 105, member A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4363 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location27655069-27681579 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 27664343 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100739] [ENSMUST00000226145] [ENSMUST00000226170] [ENSMUST00000226581]
Predicted Effect probably null
Transcript: ENSMUST00000100739
SMART Domains Protein: ENSMUSP00000098305
Gene: ENSMUSG00000056069

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Peptidase_C101 85 114 4e-10 PFAM
Pfam:Peptidase_C101 112 302 1.1e-79 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226145
Predicted Effect probably null
Transcript: ENSMUST00000226170
Predicted Effect probably benign
Transcript: ENSMUST00000226581
Predicted Effect probably benign
Transcript: ENSMUST00000231473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232492
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
9530053A07Rik T C 7: 28,146,906 S1008P probably damaging Het
Abcc2 G T 19: 43,799,136 W207L possibly damaging Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Adgrb3 A T 1: 25,112,222 V1081E probably damaging Het
Apcdd1 T A 18: 62,951,932 I400N possibly damaging Het
Bcan G T 3: 87,997,098 T117K probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cmtr1 T C 17: 29,674,232 L75P probably damaging Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Drd3 A T 16: 43,762,359 I72F probably damaging Het
Dsn1 A T 2: 156,999,142 I214K probably benign Het
Ermp1 A T 19: 29,612,876 W809R probably damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Fbxo33 T C 12: 59,204,862 H289R probably damaging Het
Gli2 T C 1: 118,853,370 N189S probably benign Het
Hus1 G T 11: 8,998,676 L242I probably damaging Het
Hyou1 G A 9: 44,380,615 probably null Het
Kirrel C A 3: 87,090,485 E244* probably null Het
Mmrn2 C T 14: 34,397,977 A268V probably damaging Het
Mycbp2 G T 14: 103,248,457 A1023E probably damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Nmnat1 T C 4: 149,473,445 I47V probably benign Het
Olfr339 A T 2: 36,421,532 I45F probably damaging Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Pak1 T C 7: 97,883,586 S198P possibly damaging Het
Pank1 A C 19: 34,827,132 V208G probably damaging Het
Pcdhga12 C G 18: 37,766,161 F15L probably benign Het
Recql4 T C 15: 76,706,044 D723G probably benign Het
Rgs22 A T 15: 36,103,874 I147N probably damaging Het
Selenbp1 A G 3: 94,942,749 probably null Het
Sspo A G 6: 48,498,731 Y4927C probably damaging Het
Syk A T 13: 52,640,730 H477L probably damaging Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Vmn2r-ps69 T C 7: 85,310,492 noncoding transcript Het
Other mutations in Fam105a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Fam105a APN 15 27658116 missense possibly damaging 0.93
IGL01662:Fam105a APN 15 27658065 missense probably damaging 1.00
IGL02991:Fam105a UTSW 15 27658302 missense possibly damaging 0.88
R0349:Fam105a UTSW 15 27664790 missense probably benign 0.01
R0726:Fam105a UTSW 15 27656947 missense probably damaging 1.00
R1054:Fam105a UTSW 15 27664549 missense probably damaging 1.00
R1201:Fam105a UTSW 15 27658173 nonsense probably null
R3001:Fam105a UTSW 15 27664706 missense probably benign 0.00
R3002:Fam105a UTSW 15 27664706 missense probably benign 0.00
R4362:Fam105a UTSW 15 27664343 critical splice donor site probably null
R5340:Fam105a UTSW 15 27658089 missense possibly damaging 0.75
R5364:Fam105a UTSW 15 27659945 nonsense probably null
R5920:Fam105a UTSW 15 27664356 missense possibly damaging 0.58
R7044:Fam105a UTSW 15 27657235 intron probably benign
R7175:Fam105a UTSW 15 27658288 missense probably damaging 1.00
R7229:Fam105a UTSW 15 27658187 missense probably benign 0.35
R7305:Fam105a UTSW 15 27658233 missense probably benign 0.07
R8346:Fam105a UTSW 15 27664558 missense probably damaging 1.00
X0025:Fam105a UTSW 15 27659942 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCTGTCCTGTCATGCTC -3'
(R):5'- CTTACTTTTAAGGGCAGAGAAGGG -3'

Sequencing Primer
(F):5'- TCACTTGAGGGACTGACCACATTAG -3'
(R):5'- TTTTAAGGGCAGAGAAGGGTCCAG -3'
Posted On2015-07-06