Incidental Mutation 'R4374:Lrsam1'
ID325017
Institutional Source Beutler Lab
Gene Symbol Lrsam1
Ensembl Gene ENSMUSG00000026792
Gene Nameleucine rich repeat and sterile alpha motif containing 1
Synonyms
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4374 (G1)
Quality Score222
Status Validated
Chromosome2
Chromosomal Location32925216-32961614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32955191 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 104 (T104K)
Ref Sequence ENSEMBL: ENSMUSP00000108825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028132] [ENSMUST00000113200] [ENSMUST00000124492] [ENSMUST00000127321] [ENSMUST00000133832] [ENSMUST00000145578] [ENSMUST00000147528] [ENSMUST00000191838]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028132
AA Change: T104K

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028132
Gene: ENSMUSG00000026792
AA Change: T104K

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113200
AA Change: T104K

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108825
Gene: ENSMUSG00000026792
AA Change: T104K

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124492
Predicted Effect probably benign
Transcript: ENSMUST00000127321
AA Change: T104K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115830
Gene: ENSMUSG00000026792
AA Change: T104K

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR_TYP 103 126 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133832
AA Change: T104K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117194
Gene: ENSMUSG00000026792
AA Change: T104K

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR_TYP 103 126 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145578
Predicted Effect probably benign
Transcript: ENSMUST00000147528
AA Change: T104K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122877
Gene: ENSMUSG00000026792
AA Change: T104K

DomainStartEndE-ValueType
Pfam:LRR_1 32 52 8.9e-2 PFAM
LRR 80 102 1.26e1 SMART
LRR 103 124 3.75e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191838
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ring finger protein involved in a variety of functions, including regulation of signaling pathways and cell adhesion, mediation of self-ubiquitylation, and involvement in cargo sorting during receptor endocytosis. Mutations in this gene have been associated with Charcot-Marie-Tooth disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mutant mice either heterozygous or homozygous for a gene trapped allele exhibit mild neuromuscular junction and axonal defects in the absence of a neuronal challenge, but show increased sensitivity to acrylamide-induced motor axon degeneration relative to control mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Lrsam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Lrsam1 APN 2 32955173 splice site probably benign
IGL01407:Lrsam1 APN 2 32947903 missense probably damaging 0.99
IGL01565:Lrsam1 APN 2 32936495 missense probably damaging 1.00
IGL01985:Lrsam1 APN 2 32928091 missense probably benign
IGL02743:Lrsam1 APN 2 32928649 splice site probably null
R0240:Lrsam1 UTSW 2 32955185 missense probably damaging 1.00
R0591:Lrsam1 UTSW 2 32933923 splice site probably benign
R0845:Lrsam1 UTSW 2 32953443 missense possibly damaging 0.94
R0945:Lrsam1 UTSW 2 32947909 missense probably benign 0.04
R1475:Lrsam1 UTSW 2 32954265 missense possibly damaging 0.48
R2147:Lrsam1 UTSW 2 32945879 missense probably damaging 1.00
R3790:Lrsam1 UTSW 2 32958159 missense probably null 1.00
R4822:Lrsam1 UTSW 2 32926792 missense probably damaging 0.99
R5014:Lrsam1 UTSW 2 32936395 intron probably benign
R5472:Lrsam1 UTSW 2 32945858 frame shift probably null
R5566:Lrsam1 UTSW 2 32941858 missense probably damaging 1.00
R5640:Lrsam1 UTSW 2 32945852 missense probably benign 0.13
R5992:Lrsam1 UTSW 2 32955222 missense probably benign 0.00
R7513:Lrsam1 UTSW 2 32953485 missense probably benign 0.02
R7515:Lrsam1 UTSW 2 32940239 critical splice donor site probably null
Z1176:Lrsam1 UTSW 2 32941814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGAAGATTCTCACAGCCAG -3'
(R):5'- GATCTGTGAGATAGAATGCGGACC -3'

Sequencing Primer
(F):5'- GAAGACTGTCACGGTCAT -3'
(R):5'- TAGAATGCGGACCGGTGG -3'
Posted On2015-07-06