Incidental Mutation 'R4374:Pramel7'
ID325018
Institutional Source Beutler Lab
Gene Symbol Pramel7
Ensembl Gene ENSMUSG00000025839
Gene Namepreferentially expressed antigen in melanoma like 7
Synonyms
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4374 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87489087-87497093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87490071 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 293 (A293T)
Ref Sequence ENSEMBL: ENSMUSP00000026957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026957]
Predicted Effect probably benign
Transcript: ENSMUST00000026957
AA Change: A293T

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000026957
Gene: ENSMUSG00000025839
AA Change: A293T

DomainStartEndE-ValueType
SCOP:d1a4ya_ 207 407 3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148030
Meta Mutation Damage Score 0.0850 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Ppp6r2 T G 15: 89,265,158 C216W probably damaging Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Pramel7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Pramel7 APN 2 87491085 missense probably damaging 1.00
IGL01302:Pramel7 APN 2 87491373 missense possibly damaging 0.58
IGL01365:Pramel7 APN 2 87491413 splice site probably benign
IGL01728:Pramel7 APN 2 87491330 missense possibly damaging 0.95
IGL01769:Pramel7 APN 2 87489588 missense probably benign 0.09
IGL01932:Pramel7 APN 2 87491113 missense possibly damaging 0.80
IGL02971:Pramel7 APN 2 87490073 missense probably benign 0.03
IGL03376:Pramel7 APN 2 87489603 missense probably damaging 1.00
IGL03380:Pramel7 APN 2 87491372 missense probably benign 0.38
R0625:Pramel7 UTSW 2 87491008 missense probably benign 0.02
R1077:Pramel7 UTSW 2 87491190 missense probably damaging 1.00
R1455:Pramel7 UTSW 2 87489723 missense probably benign 0.00
R1666:Pramel7 UTSW 2 87492403 missense probably damaging 0.99
R1863:Pramel7 UTSW 2 87491331 missense probably benign 0.35
R1977:Pramel7 UTSW 2 87491121 missense probably benign 0.01
R2141:Pramel7 UTSW 2 87489977 missense probably damaging 1.00
R3027:Pramel7 UTSW 2 87491403 missense probably benign 0.01
R4735:Pramel7 UTSW 2 87490843 nonsense probably null
R5232:Pramel7 UTSW 2 87489976 missense probably damaging 0.97
R6255:Pramel7 UTSW 2 87489663 missense probably benign 0.00
R6611:Pramel7 UTSW 2 87490049 missense probably damaging 1.00
R6898:Pramel7 UTSW 2 87489726 missense probably damaging 0.98
R7246:Pramel7 UTSW 2 87492165 missense probably damaging 1.00
R7293:Pramel7 UTSW 2 87492362 missense probably benign 0.28
R7408:Pramel7 UTSW 2 87490845 missense possibly damaging 0.89
R7431:Pramel7 UTSW 2 87489938 missense possibly damaging 0.65
R7469:Pramel7 UTSW 2 87491404 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGCAGGTTAGCTGCAACAC -3'
(R):5'- ACACTGTCATGGATTCCAACTTTC -3'

Sequencing Primer
(F):5'- GGTTAGCTGCAACACGCTTTAAG -3'
(R):5'- GTGGTCCCTATTAGCCTAAAGAC -3'
Posted On2015-07-06